
Concept explainers
Which of the following traits would you expect to be inherited as quantitative traits?
a. body weight in chickens
b. growth rate in sheep
c. milk production in cattle
d. fruit weight in tomatoes
e. coat color in dogs

To analyze:
Determine the expected quantitative traits from the following:
Body weight in chicken
Growth rate in sheep
Milk production in cattle
Fruits weight in tomatoes
Coat color in dogs
Introduction:
Multifactorial traits are the results of genetic and non-genetic variation that can contribute to the variation in phenotypes of certain traits. These multifactorial traits can be classified as quantitative traits or qualitative traits. Qualitative phenotypic variations are discontinuous variation whereas quantitative phenotypic variations are continuous variation. The effect of multiple genes which exerts same or different amount of influence on the phenotypes leads to the continuous variation in the phenotypes of polygenic traits. The influence of multiple genes leads to a number of traits called polygenic traits. The incremental contributions by multiple genes result in continuous phenotypic variation. These multiple genes are called additive genes and their effects are called additive gene effects.
Explanation of Solution
The additive effects of multiple genes contribute to the body weight of the chicken. But chickens have different body mass which suggests that each gene contributes a certain quantity of body weight. This difference in body mass is responsible for continuous variation. Therefore, it is a quantitative trait.
Continuous variation is also seen in the growth rate of sheep. The additive effect of multiple genes is responsible for different growth rates. So, the growth rate in sheep is a quantitative trait.
The amount of milk produced by each cattle is varying continuously. This suggests that the phenotypic trait is controlled by a number of genes. Each gene may add a certain quantity of milk. Therefore, milk production in cattle is a quantitative trait.
Tomatoes are also have different weights. This difference in the weight of tomatoes is contributed by different genes. This suggests that continuous variation in weight difference is an additive gene effect. Therefore, fruit weight in tomatoes is a quantitative trait.
It is observed that the coat color of the dogs is not continuously varied. Contrast is present in the coat color of dogs. Therefore, coat color in dogs is not a quantitative trait.
The quantitative traits are classified based on continuous and discontinuous phenotypic variation.
Want to see more full solutions like this?
Chapter 19 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Additional Science Textbook Solutions
Applications and Investigations in Earth Science (9th Edition)
Organic Chemistry (8th Edition)
Concepts of Genetics (12th Edition)
Cosmic Perspective Fundamentals
Chemistry: The Central Science (14th Edition)
Campbell Biology in Focus (2nd Edition)
- Don't copy the other answerarrow_forward4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is equivalent to acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source. NADH FADH2 OP ATP Show your work using dimensional analysis here: SLP ATP Total ATParrow_forwardBiology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forward
- Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forward
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning


