
Concept explainers
Although histone modifications can activate or silence genes, these covalent alterations are made to protein molecules involved in nucleosome structure and not to the DNA carrying the activated or silenced allele. If the fixed pattern of active and silenced alleles is to be carried through multiple cell divisions, would you expect the histone modifications to be in cis or trans to the affected alleles? Why?
Hint: This problem involves an understanding of how many copies of each histone are contained in a nucleosome and of the spatial relationship between the histones and the DNA wound around the nucleosome.

To determine: The presence of cis or trans histone modifications in the affected alleles in several cell divisions.
Introduction: The mutation is the change in the nucleotide sequence of the gene, which result in either the formation of a defective protein or no protein at all. The mutation can also alter the regulation of certain genes leading to their hyperactivity or hypoactivity.
Explanation of Solution
The activation of the gene can only take place when the chromatin that contains the gene and its respective regulatory regions to be present in the “open state.” Similarly, for the silencing of the gene, the chromatin containing the gene and its regulatory regions need to be present in a closed state. When these chromatin structures undergo and persist through several cell divisions, the histones that are present in the immediate proximity of the gene, that is cis state will be carrying the histone modifications.
The gene in the chromatin will have to be in a cis state to carry the histone modifications under multiple cell divisions.
Want to see more full solutions like this?
Chapter 19 Solutions
Concepts of Genetics (12th Edition)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax





