
Concept explainers
Consider the fact that the use of 16S rRNA sequencing as a taxonomic and phylogenetic tool has resulted in tripling the number of bacterial phyla. Why has the advent of this genetic technique expanded the currently accepted number of microbial phyla?

The taxonomy is the study of classification and naming the organism based on their shared characteristic features. Phylogeny is the study of evolutionary changes occurs in an organism or group of organism. Gene sequencing is a genetic tool or phylogenetic tool that expands the number of microbial phyla.
Explanation of Solution
Prokaryotes have 70S ribosome which is divided into 30S and 40S subunits. 30S subunit consists of 16S ribosomal RNA (16S rRNA). The gene that codes for 16S rRNA is called 16S rRNA gene and the nucleotide sequencing of this gene is called 16S rRNA sequencing. It is used in reconstructing microbial phyla since the rate of evolution at this region is very slow. This tool allows the discovery of many new organisms.
Earlier to this genetic tool classification was made on the basis of morphological, biochemical, and physiological characteristics of the organism. Distinguishing phyla based on these characteristic features do not give much resolution as 16S rRNA.
16S rRNA sequencing tool overcomes some problems with conventional classification method. One such problem is culturing the microbes in the lab. Some microbes cannot be cultured or very difficult to culture in a lab. These microbes also can be identified using 16S rRNA sequencing.
Therefore, the advent of this genetic technique currently expanded the number of microbial phyla.
Want to see more full solutions like this?
Chapter 19 Solutions
Prescott's Microbiology
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning




