
Concept explainers
(a)
Interpretation: Among the terms glycerophospholipid, sphingophospholipid and sphingoglycolipids, the term that can be applied to the given characterization has to be predicted.
Concept introduction: The lipid that is composed of one fatty acid and one carbohydrate unit which are joined to a sphingosine molecule is known as sphingoglycolipid. The fatty acid of sphingoglycolipid is also joined to the sphingosine molecule with the help of amide linkage. The carbohydrate unit joined to a sphingosine molecule with the help of glycosidic linkage.
The lipids based on glycerol are called glycerophospholipids. They are basically made up of two fatty acids, a phosphate group which is esterified to glycerol and an alcohol group which is esterified to the phosphate group.
The lipids that are composed of a fatty acid and a phosphate group which is joined with a sphingosine molecule and an alcoholic group is known as sphingophospholipids.
(b)
Interpretation: Among the terms glycerophospholipid, sphingophospholipid and sphingoglycolipids, the term that can be applied to the given characterization has to be predicted.
Concept introduction: The lipid that is composed of one fatty acid and one carbohydrate unit which are joined to a sphingosine molecule is known as sphingoglycolipid. The fatty acid of sphingoglycolipid is also joined to the sphingosine molecule with the help of amide linkage. The carbohydrate unit joined to a sphingosine molecule with the help of glycosidic linkage.
The lipids based on glycerol are called glycerophospholipids. They are basically made up of two fatty acids, a phosphate group which is esterified to glycerol and an alcohol group which is esterified to the phosphate group.
The lipids that are composed of a fatty acid and a phosphate group which is joined with a sphingosine molecule and an alcoholic group is known as sphingophospholipids.
(c)
Interpretation: Among the terms glycerophospholipid, sphingophospholipid and sphingoglycolipid, the term that can be applied to the given characterization has to be predicted.
Concept introduction: The lipid that is composed of one fatty acid and one carbohydrate unit which are joined to a sphingosine molecule is known as sphingoglycolipid. The fatty acid of sphingoglycolipid is also joined to the sphingosine molecule with the help of amide linkage. The carbohydrate unit joined to a sphingosine molecule with the help of glycosidic linkage.
The lipids based on glycerol are called glycerophospholipids. They are basically made up of two fatty acids, a phosphate group which is esterified to glycerol and an alcohol group which is esterified to the phosphate group.
The lipids that are composed of a fatty acid and a phosphate group which is joined with a sphingosine molecule and an alcoholic group is known as sphingophospholipids.
(d)
Interpretation: Among the terms glycerophospholipid, sphingophospholipid and sphingoglycolipids, the term that can be applied to the given characterization has to be predicted.
Concept introduction: The lipid that is composed of one fatty acid and one carbohydrate unit which are joined to a sphingosine molecule is known as sphingoglycolipid. The fatty acid of sphingoglycolipid is also joined to the sphingosine molecule with the help of amide linkage. The carbohydrate unit joined to a sphingosine molecule with the help of glycosidic linkage.
The lipids based on glycerol are called glycerophospholipids. They are basically made up of two fatty acids, a phosphate group which is esterified to glycerol and an alcohol group which is esterified to the phosphate group.
The lipids that are composed of a fatty acid and a phosphate group which is joined with a sphingosine molecule and an alcoholic group is known as sphingophospholipids.

Want to see the full answer?
Check out a sample textbook solution
Chapter 19 Solutions
Bundle: General, Organic, and Biological Chemistry, 7th + OWLv2 Quick Prep for General Chemistry, 4 terms (24 months) Printed Access Card
- Aerobic respiration of one lipid molecule. The lipid is composed of one glycerol molecule connected to two fatty acid tails. One fatty acid is 12 carbons long and the other fatty acid is 18 carbons long in the figure below. Use the information below to determine how much ATP will be produced from the glycerol part of the lipid. Then, in part B, determine how much ATP is produced from the 2 fatty acids of the lipid. Finally put the NADH and ATP yields together from the glycerol and fatty acids (part A and B) to determine your total number of ATP produced per lipid. Assume no other carbon source is available. 18 carbons fatty acids 12 carbons glycerol . Glycerol is broken down to glyceraldehyde 3-phosphate, a glycolysis intermediate via the following pathway shown in the figure below. Notice this process costs one ATP but generates one FADH2. Continue generating ATP with glyceraldehyde-3-phosphate using the standard pathway and aerobic respiration. glycerol glycerol-3- phosphate…arrow_forwardDon't copy the other answerarrow_forward4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is equivalent to acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source. NADH FADH2 OP ATP Show your work using dimensional analysis here: SLP ATP Total ATParrow_forward
- Biology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forwardWrite the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forward
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax





