
Anatomy & Physiology (6th Edition)
6th Edition
ISBN: 9780134156415
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 18.11, Problem 23CYU
Summary Introduction
To review:
Name of the veins which drain the dural venous sinuses; and the area of their termination.
Introduction:
Arteries, veins, and capillaries are the major blood vessels carrying blood. Veins are the blood vessels that carry blood from the tissues towards the heart from various capillary beds. The capillaries unite to form large venules and venules finally join to form veins. Vena cava is one of the largest veins, which branches to the form superior and inferior vena cava.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 18 Solutions
Anatomy & Physiology (6th Edition)
Ch. 18.1 - Which branch of the autonomic nervous system...Ch. 18.1 - When vascular smooth muscle contracts, what...Ch. 18.2 - Name the type of artery that matches each...Ch. 18.3 - Prob. 4CYUCh. 18.4 - Prob. 5CYUCh. 18.4 - In the systemic circuit, which contains more...Ch. 18.5 - Prob. 7CYUCh. 18.6 - List three factors that determine resistance in a...Ch. 18.6 - Suppose vasoconstriction decreases the diameter of...Ch. 18.7 - Prob. 10CYU
Ch. 18.8 - Prob. 11CYUCh. 18.8 - The kidneys play an important role in maintaining...Ch. 18.8 - Your neighbor, Bob, calls you because he thinks he...Ch. 18.8 - Prob. 14CYUCh. 18.9 - Suppose you are in a bicycle race. What happens to...Ch. 18.9 - If many arterioles in your body dilated at once,...Ch. 18.10 - Prob. 17CYUCh. 18.11 - Prob. 18CYUCh. 18.11 - Prob. 19CYUCh. 18.11 - Prob. 20CYUCh. 18.11 - You are assessing the circulation in the leg of a...Ch. 18.11 - In what important way does the area drained by the...Ch. 18.11 - Prob. 23CYUCh. 18.11 - Prob. 24CYUCh. 18.11 - Name the leg veins that often become varicosed.Ch. 18 - Which statement does not accurately describe...Ch. 18 - Smooth muscle in the blood vessel wall (a) is...Ch. 18 - Peripheral resistance (a) is inversely...Ch. 18 - Which of the following can lead to decreased...Ch. 18 - Prob. 5MCCh. 18 - Prob. 6MCCh. 18 - The structure of a capillary wall differs from...Ch. 18 - Prob. 8MCCh. 18 - The myocardium receives its blood supply directly...Ch. 18 - Blood flow in the capillaries is steady despite...Ch. 18 - Prob. 11MCCh. 18 - Tracing the blood from the heart to the right...Ch. 18 - Prob. 13MCCh. 18 - Prob. 14MCCh. 18 - How is the anatomy of capillaries and capillary...Ch. 18 - Prob. 16SAQCh. 18 - Write an equation showing the relationship between...Ch. 18 - Prob. 18SAQCh. 18 - Describe the neural mechanisms responsible for...Ch. 18 - Explain the reasons for the observed changes in...Ch. 18 - Prob. 21SAQCh. 18 - Prob. 22SAQCh. 18 - How are nutrients, wastes, and respiratory gases...Ch. 18 - Prob. 24SAQCh. 18 - Physiologists often consider capillaries and...Ch. 18 - Mr. Hutchinson, another middle-aged victim of the...Ch. 18 - Mr. Hutchinson, another middle-aged victim of the...Ch. 18 - Mr. Hutchinson, another middle-aged victim of the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:Cengage
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning