Pollen grains form the male gametophyte phase of the plant. Pollen grains are produced by meiosis. Inside the pollen there are two cells that comprise the male gametophyte. The tube cell develops into the pollen tube. The germ cell divides by mitosis to produce two sperm cells.

Question

Want to see the full answer?

Answer 1

Question

Chapter 18, Problem 4MC

Summary Introduction

Introduction:

Pollen grains form the male gametophyte phase of the plant. Pollen grains are produced by meiosis. Inside the pollen there are two cells that comprise the male gametophyte. The tube cell develops into the pollen tube. The germ cell divides by mitosis to produce two sperm cells.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

What would happen if transcriptome analysis were done on liver and muscle cells?

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

Answer 2

Question

Chapter 18, Problem 4MC

Summary Introduction

Introduction:

Pollen grains form the male gametophyte phase of the plant. Pollen grains are produced by meiosis. Inside the pollen there are two cells that comprise the male gametophyte. The tube cell develops into the pollen tube. The germ cell divides by mitosis to produce two sperm cells.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 18, Problem 4MC

Summary Introduction

Introduction:

Pollen grains form the male gametophyte phase of the plant. Pollen grains are produced by meiosis. Inside the pollen there are two cells that comprise the male gametophyte. The tube cell develops into the pollen tube. The germ cell divides by mitosis to produce two sperm cells.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 18, Problem 4MC

Summary Introduction

Introduction:

Pollen grains form the male gametophyte phase of the plant. Pollen grains are produced by meiosis. Inside the pollen there are two cells that comprise the male gametophyte. The tube cell develops into the pollen tube. The germ cell divides by mitosis to produce two sperm cells.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 18, Problem 4MC

Summary Introduction

Introduction:

Pollen grains form the male gametophyte phase of the plant. Pollen grains are produced by meiosis. Inside the pollen there are two cells that comprise the male gametophyte. The tube cell develops into the pollen tube. The germ cell divides by mitosis to produce two sperm cells.

Answer 6

Chapter 18, Problem 4MC

Summary Introduction

Introduction:

Pollen grains form the male gametophyte phase of the plant. Pollen grains are produced by meiosis. Inside the pollen there are two cells that comprise the male gametophyte. The tube cell develops into the pollen tube. The germ cell divides by mitosis to produce two sperm cells.

Answer 7

Chapter 18, Problem 4MC

Summary Introduction

Introduction:

Pollen grains form the male gametophyte phase of the plant. Pollen grains are produced by meiosis. Inside the pollen there are two cells that comprise the male gametophyte. The tube cell develops into the pollen tube. The germ cell divides by mitosis to produce two sperm cells.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 18 - Prob. 1SA Ch. 18 - Prob. 2SA Ch. 18 - Prob. 3SA Ch. 18 - Prob. 4SA Ch. 18 - Prob. 5SA Ch. 18 - Prob. 6SA Ch. 18 - Prob. 7SA Ch. 18 - Prob. 8SA Ch. 18 - Prob. 9SA Ch. 18 - Prob. 10SA

Pollen grains form the male gametophyte phase of the plant. Pollen grains are produced by meiosis. Inside the pollen there are two cells that comprise the male gametophyte. The tube cell develops into the pollen tube. The germ cell divides by mitosis to produce two sperm cells.

Solution Summary: The author explains that angiosperm pollen grains form the male gametophyte phase of the plant.

Concept explainers

Videos

Introduction:

Pollen grains form the male gametophyte phase of the plant. Pollen grains are produced by meiosis. Inside the pollen there are two cells that comprise the male gametophyte. The tube cell develops into the pollen tube. The germ cell divides by mitosis to produce two sperm cells.

Want to see the full answer?

Chapter 18 Solutions

Pollen grains form the male gametophyte phase of the plant. Pollen grains are produced by meiosis. Inside the pollen there are two cells that comprise the male gametophyte. The tube cell develops into the pollen tube. The germ cell divides by mitosis to produce two sperm cells.

Solution Summary: The author explains that angiosperm pollen grains form the male gametophyte phase of the plant.

Concept explainers

Videos

Introduction: Pollen grains form the male gametophyte phase of the plant. Pollen grains are produced by meiosis. Inside the pollen there are two cells that comprise the male gametophyte. The tube cell develops into the pollen tube. The germ cell divides by mitosis to produce two sperm cells.

Want to see the full answer?

Chapter 18 Solutions

Introduction:

Pollen grains form the male gametophyte phase of the plant. Pollen grains are produced by meiosis. Inside the pollen there are two cells that comprise the male gametophyte. The tube cell develops into the pollen tube. The germ cell divides by mitosis to produce two sperm cells.