Concepts of Genetics Plus Mastering Genetics with Pearson eText -- Access Card Package (12th Edition) (What's New in Genetics)
12th Edition
ISBN: 9780134811390
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 18, Problem 20PDQ
How is it possible that a given mRNA in a cell is found throughout the cytoplasm but the protein that it encodes is only found in a few specific regions?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example.
ATGATAGCCAGACTCGCA
The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some
tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with
an example.
ATGATAGCACCAGACTCGCA
The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example.
ATAAGCCAGACTCAGCA
Chapter 18 Solutions
Concepts of Genetics Plus Mastering Genetics with Pearson eText -- Access Card Package (12th Edition) (What's New in Genetics)
Ch. 18 - Some mutations in the tra gene of Drosophila cause...Ch. 18 - Some scientists use the analogy that the...Ch. 18 - Consider the example that actin mRNA localization...Ch. 18 - What is alternative splicing, where does it occur,...Ch. 18 - What role might the expanded tri- and...Ch. 18 - DM1 is characterized by a phenomenon known as...Ch. 18 - HOW DO WE KNOW? In this chapter, we focused on how...Ch. 18 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 18 - List three types of alternative splicing patterns...Ch. 18 - Consider the CT/CGRP example of alternative...
Ch. 18 - Explain how the use of alternative promoters and...Ch. 18 - Explain how a tissue-specific RNA-binding protein...Ch. 18 - The regulation of mRNA decay relies heavily upon...Ch. 18 - Nonsense-mediated decay is an mRNA surveillance...Ch. 18 - AU-rich elements (AREs) are cis-elements in mRNAs...Ch. 18 - What are processing bodies (P bodies), and what...Ch. 18 - In 1998, future Nobel laureates Andrew Fire and...Ch. 18 - Present an overview of RNA interference (RNAi)....Ch. 18 - RNAi may be directed by small interfering RNAs...Ch. 18 - Prob. 14PDQCh. 18 - In principle, RNAi may be used to fight viral...Ch. 18 - Prob. 16PDQCh. 18 - Prob. 17PDQCh. 18 - Prob. 18PDQCh. 18 - Prob. 19PDQCh. 18 - How is it possible that a given mRNA in a cell is...Ch. 18 - Prob. 21PDQCh. 18 - Prob. 22PDQCh. 18 - Prob. 23PDQCh. 18 - Prob. 24ESPCh. 18 - Prob. 25ESPCh. 18 - Mutations in the low-density lipoprotein receptor...Ch. 18 - RNA helicases are a class of proteins that bind...Ch. 18 - While miRNA response elements (MREs) may be...Ch. 18 - RNAi is currently being tested as a therapeutic...Ch. 18 - The localization and translational control of...Ch. 18 - Explain how the expression of a single gene can be...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The asterisk (*) in the diagram below indicates a single base mutation in the 5' splice site of the second intron of a eukaryotic gene. Due to this mutation, the second intron is now not ‘spliced out’ during the splicing process. What are the most likely consequences of this mutation with respect to the size of the pre-mRNA and the size of the mature mRNA? a. The pre-mRNA will be longer and the mature mRNA will be longer. b. The pre-mRNA will be longer and the size of the mature mRNA will not be affected c. The size of the pre-mRNA will not be affected and the mature mRNA will be longer d. The size of the pre-mRNA will not be affected and the size of the mature mRNA will not be affectedarrow_forwardif a protein that contain the two codon sequences showed a molar mass of 97,313 g /mol and the UV data showed that it contains 0.67 % Tyrosine amino acid by weight. How many Tyrosine amino acids this protein contain? If this protein that was formed contains a total of 865 amino acids long, how many nucleic acids are there in the mRNA including the initiator and the terminator codons?arrow_forwardEukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation. One of the processing steps is splicing, where portions of the RNA are removed and the remaining RNA are joined together. Classify the statements regarding mRNA splicing as true or false. True statements Splicing of mRNA does not involve any proteins. Answer Bank Splicing occurs while the mRNA is attached to the spliceosome. In splicing, intron sequences are removed from the mRNA in the form of lariats (loops) and are degraded. One mRNA can sometimes code for more than one protein by splicing at alternative sites. False statements Splicing occurs after the mRNA enters the cytoplasm but before it binds to the ribosome.arrow_forward
- a) Two of the following three mRNA sequences code for the same protein. Delete the sequence which does NOT code for the same protein as the other two. [ /1] #1 UUU CCU AGU GGU #2 UUC CCA AGC GGC #3 UUC CCG AGA GGA b) Despite the fact that one of the mRNA sequences above codes for a different protein, it IS possible that it will be translated into the same protein as the other two. Based on what you have learned in this unit, explain how this might happen.arrow_forwardConsider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for additional information. Part 1 of 5 What amino acid sequence is coded for by this mRNA? Leu-Thr-Asp Part 2 of 5 What is the amino acid sequence if a mutation converts UUG to UUA? Leu-Thr-Asp Part 3 of 5 What is the amino acid sequence if a mutation converts ACC to AGC? Leu-Ser-Asp Part: 3/5 Part 4 of 5 What is the amino acid sequence if a mutation converts GAC to CACTarrow_forwardConsider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for additional information. Part 1 of 5 What amino acid sequence is coded for by this mRNA? Leu-Thr-Asp Part 2 of 5 What is the amino acid sequence if a mutation converts UUG to UUA? Leu-Thr-Asp Part 3 of 5 What is the amino acid sequence if a mutation converts ACC to AGC? Leu-Ser-Asp Part 4 of 5 What is the amino acid sequence if a mutation converts GAC to CACT Leu-Thr-His Part: 4/5 Part 5 of 5 What is the amino acid sequence if G is added to the beginning of the chain? x Sarrow_forward
- Imagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow Fluorescent Protein (YFP). To generate the YFP, you know the pre-MRNA looks as follows: Unspliced YFP premature mRNA Сap 5' UTR Exon 1 Intron Exon 2 Intron Exon 3 3' UTR Poly-A tail If Exon 2 is also required for mRNA stability, what can be predicted from the possible spliced alternative isoforms formed? One of the isoforms will not have a poly-A tail O The alternative splicing of YFP pre-MRNA prevents 5'-capping The MRNA isoform without Exon 2 will be degraded faster than the other isoform Exon 2 will be added to isoform B later to correct the mistake in splicing The protein translated from one of the mRNA isoforms will possess an additional functional domainarrow_forwardAfter the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief moment occurs before the two exons are connected to each other. Which snRNP(s) hold(s) the exons in place so they can be covalently connected to each other?arrow_forwardEukaryotic mRNA has a significantly longer half life than its prokaryotic counterpart. How is this accomplished in eukaryotes? What processes tend to degrade mRNA molecules in both eukaryotes and prokaryotes, and why are these processes needed?arrow_forward
- Consider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for additional information. Part: 0 / 5 Part 1 of 5 What amino acid sequence is coded for by this mRNA? ☑arrow_forwardEukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation. One of the processing steps is splicing, where portions of the RNA are removed and the remaining RNA are joined together. Classify the statements regarding mRNA splicing as true or false. True statements False statements In splicing, intron sequences are removed from the mRNA in the form of lariats (loops) and are degraded. Splicing occurs while the mRNA is still in the nucleus. Splicing of mRNA does not involve any proteins. One MRNA can sometimes code for more than one protein by splicing at alternative sites. Splicing occurs while the mRNA is attached to the nucleosome.arrow_forwardIn eukaryotic mRNA there are 90 nucleotide involved in translation process. What is the number of amino acid in the protein formed by this mRNA molecule?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY