Biology
Biology
3rd Edition
ISBN: 9781259824913
Author: Hoefnagels, Mariëlle
Publisher: Mcgraw-hill Education,
bartleby

Concept explainers

Question
Book Icon
Chapter 17.8, Problem 4MC
Summary Introduction

To determine:

The different functions of the exoskeleton.

Introduction:

Arthropods have a unique and jointed exoskeleton. The exoskeleton consists of a thin, outer protein layer called epicuticle, and the thick inner chitin-protein layer called the procuticle. It is a key feature of arthropods such as insects, spiders, and crustaceans.

Blurred answer
Students have asked these similar questions
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Which marker does this DNA  5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

Chapter 17 Solutions

Biology

Ch. 17.3 - Prob. 1MCCh. 17.3 - Prob. 2MCCh. 17.3 - Prob. 3MCCh. 17.3 - Prob. 4MCCh. 17.4 - Prob. 1MCCh. 17.4 - How does the body shape of a flatworm enhance gas...Ch. 17.4 - Prob. 3MCCh. 17.4 - Prob. 4MCCh. 17.5 - Prob. 1MCCh. 17.5 - Prob. 2MCCh. 17.5 - Prob. 3MCCh. 17.6 - What features do all annelids share?Ch. 17.6 - List examples of animals in each of the two...Ch. 17.6 - Prob. 3MCCh. 17.7 - Prob. 1MCCh. 17.7 - Prob. 2MCCh. 17.7 - Prob. 3MCCh. 17.7 - Prob. 4MCCh. 17.8 - Prob. 1MCCh. 17.8 - Prob. 2MCCh. 17.8 - Prob. 3MCCh. 17.8 - Prob. 4MCCh. 17.8 - Prob. 5MCCh. 17.8 - Prob. 6MCCh. 17.9 - What characteristics distinguish the echinoderms?Ch. 17.9 - Prob. 2MCCh. 17.9 - In what ways are echinoderms important?Ch. 17.10 - Prob. 1MCCh. 17.10 - Prob. 2MCCh. 17.10 - Prob. 3MCCh. 17.10 - Prob. 4MCCh. 17.11 - What is the relationship among tunicates,...Ch. 17.11 - Make a table comparing the features of each...Ch. 17.11 - Prob. 3MCCh. 17.11 - Prob. 4MCCh. 17.12 - Prob. 1MCCh. 17.12 - What can skeletal anatomy and DNA sequences in...Ch. 17.12 - What are the four groups of species in the hominin...Ch. 17.12 - Prob. 4MCCh. 17 - Following gastrulation, the cells that have folded...Ch. 17 - Prob. 2MCQCh. 17 - Prob. 3MCQCh. 17 - How is the body structure of an annelid different...Ch. 17 - Prob. 5MCQCh. 17 - Prob. 6MCQCh. 17 - Echinoderms have ____ symmetry as embryos and ____...Ch. 17 - Prob. 8MCQCh. 17 - Which of the following has pharyngeal slits at...Ch. 17 - Lobe-finned fishes are important because they a...Ch. 17 - To which of the following is a salamander most...Ch. 17 - How do reptiles and mammals differ from...Ch. 17 - Which of the following represents the correct...Ch. 17 - Primates share all of the following...Ch. 17 - DNA evidence suggests that modern humans a. share...Ch. 17 - Compare the nine major animal phyla in the order...Ch. 17 - Prob. 2WIOCh. 17 - Using the evolutionary trees in this chapter,...Ch. 17 - Prob. 4WIOCh. 17 - Prob. 5WIOCh. 17 - Prob. 6WIOCh. 17 - Prob. 7WIOCh. 17 - Create lists of animal phyla that a are...Ch. 17 - Prob. 9WIOCh. 17 - Draw from memory a phylogenetic tree that traces...Ch. 17 - Prob. 11WIOCh. 17 - List the evidence that biologists use to classify...Ch. 17 - Prob. 13WIOCh. 17 - Prob. 14WIOCh. 17 - Prob. 15WIOCh. 17 - Prob. 16WIOCh. 17 - Prob. 17WIOCh. 17 - Prob. 18WIOCh. 17 - In what ways has culture been an important factor...Ch. 17 - Prob. 20WIOCh. 17 - How do you predict a scientist would respond to a...Ch. 17 - Prob. 22WIOCh. 17 - Prob. 1SLCh. 17 - Prob. 2SLCh. 17 - Prob. 1PITCh. 17 - Prob. 2PITCh. 17 - Draw a concept map that summarizes the chordates,...Ch. 17 - Add tunicates, hagfishes, birds, monotremes,...Ch. 17 - Other than the ones pictured, give an example of a...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Text book image
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Text book image
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning