The different functions of the exoskeleton. Introduction: Arthropods have a unique and jointed exoskeleton. The exoskeleton consists of a thin, outer protein layer called epicuticle, and the thick inner chitin-protein layer called the procuticle. It is a key feature of arthropods such as insects, spiders, and crustaceans.

Question

Want to see the full answer?

Answer 1

Question

Chapter 17.8, Problem 4MC

Summary Introduction

To determine:

The different functions of the exoskeleton.

Introduction:

Arthropods have a unique and jointed exoskeleton. The exoskeleton consists of a thin, outer protein layer called epicuticle, and the thick inner chitin-protein layer called the procuticle. It is a key feature of arthropods such as insects, spiders, and crustaceans.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

What would happen if transcriptome analysis were done on liver and muscle cells?

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

Answer 2

Question

Chapter 17.8, Problem 4MC

Summary Introduction

To determine:

The different functions of the exoskeleton.

Introduction:

Arthropods have a unique and jointed exoskeleton. The exoskeleton consists of a thin, outer protein layer called epicuticle, and the thick inner chitin-protein layer called the procuticle. It is a key feature of arthropods such as insects, spiders, and crustaceans.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 17.8, Problem 4MC

Summary Introduction

To determine:

The different functions of the exoskeleton.

Introduction:

Arthropods have a unique and jointed exoskeleton. The exoskeleton consists of a thin, outer protein layer called epicuticle, and the thick inner chitin-protein layer called the procuticle. It is a key feature of arthropods such as insects, spiders, and crustaceans.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 17.8, Problem 4MC

Summary Introduction

To determine:

The different functions of the exoskeleton.

Introduction:

Arthropods have a unique and jointed exoskeleton. The exoskeleton consists of a thin, outer protein layer called epicuticle, and the thick inner chitin-protein layer called the procuticle. It is a key feature of arthropods such as insects, spiders, and crustaceans.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 17.8, Problem 4MC

Summary Introduction

To determine:

The different functions of the exoskeleton.

Introduction:

Arthropods have a unique and jointed exoskeleton. The exoskeleton consists of a thin, outer protein layer called epicuticle, and the thick inner chitin-protein layer called the procuticle. It is a key feature of arthropods such as insects, spiders, and crustaceans.

Answer 6

Chapter 17.8, Problem 4MC

Summary Introduction

To determine:

The different functions of the exoskeleton.

Introduction:

Arthropods have a unique and jointed exoskeleton. The exoskeleton consists of a thin, outer protein layer called epicuticle, and the thick inner chitin-protein layer called the procuticle. It is a key feature of arthropods such as insects, spiders, and crustaceans.

Answer 7

Chapter 17.8, Problem 4MC

Summary Introduction

To determine:

The different functions of the exoskeleton.

Introduction:

Arthropods have a unique and jointed exoskeleton. The exoskeleton consists of a thin, outer protein layer called epicuticle, and the thick inner chitin-protein layer called the procuticle. It is a key feature of arthropods such as insects, spiders, and crustaceans.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 17.1 - Prob. 1MC Ch. 17.1 - Prob. 2MC Ch. 17.1 - What features were used to build the animal...Ch. 17.1 - Prob. 4MC Ch. 17.1 - Prob. 5MC Ch. 17.1 - What advantages does segmentation confer?Ch. 17.2 - Prob. 1MC Ch. 17.2 - Prob. 2MC Ch. 17.2 - Prob. 3MC Ch. 17.2 - Prob. 4MC

Solution Summary: The author explains the various functions of the exoskeleton of arthropods. It is a rigid outer covering that protects and provides structural support to the body.

Concept explainers

Want to see the full answer?

Chapter 17 Solutions