
Biology: Concepts and Investigations
4th Edition
ISBN: 9780078024207
Author: Mariëlle Hoefnagels Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 17.2, Problem 2MC
Summary Introduction
To sketch:
The internal and external features of a typical prokaryotic cell and also determine the functions of each structure.
Concept introduction:
Prokaryotes are unicellular, microscopic organisms that are not visible to the naked eye. They can be observed only under either a light microscope or an electron microscope.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 17 Solutions
Biology: Concepts and Investigations
Ch. 17.1 - What are two domains that contain prokaryotes?Ch. 17.1 - Prob. 2MCCh. 17.1 - Prob. 3MCCh. 17.1 - Why are most species of prokaryotes little...Ch. 17.2 - Prob. 1MCCh. 17.2 - Prob. 2MCCh. 17.2 - What does the Gram stain reveal about a cell?Ch. 17.2 - Prob. 4MCCh. 17.2 - How are molecular data changing microbial...Ch. 17.2 - Prob. 6MC
Ch. 17.3 - Prob. 1MCCh. 17.3 - Prob. 2MCCh. 17.3 - Prob. 3MCCh. 17.4 - Prob. 1MCCh. 17.4 - Prob. 2MCCh. 17.4 - What adaptations enable pathogenic bacteria to...Ch. 17.4 - What are some practical uses of bacteria and...Ch. 17.5 - Prob. 1MCCh. 17.5 - Prob. 2MCCh. 17 - A prokaryotic cell is one that a. lacks DNA. b....Ch. 17 - Which of these is a distinguishing characteristic...Ch. 17 - What feature distinguishes the cell walls of...Ch. 17 - What type of organism may use inorganic chemicals...Ch. 17 - Prob. 5MCQCh. 17 - Prob. 6MCQCh. 17 - Prob. 7MCQCh. 17 - Prob. 8MCQCh. 17 - Explain why the antibiotics penicillin and...Ch. 17 - Why do some microbiologists disagree with...Ch. 17 - Give five examples that illustrate how bacteria...Ch. 17 - If you were developing a new "broad-spectrum"...Ch. 17 - Describe your own metabolic classification: Are...Ch. 17 - A prokaryote with which type of metabolism would...Ch. 17 - Ernst Mayr defined a biological species as a...Ch. 17 - Why did the discovery of archaea generate interest...Ch. 17 - In an article in Nature magazine, Sean Nee wrote...Ch. 17 - Ecosystems rely on nitrogen -fixing bacteria,...Ch. 17 - Prob. 11WIOCh. 17 - Prob. 12WIOCh. 17 - Prob. 13WIOCh. 17 - Prob. 14WIOCh. 17 - Prob. 15WIOCh. 17 - Mycobacterium tuberculosis causes most cases of...Ch. 17 - Prob. 1PITCh. 17 - Add autotrophs, heterotrophs, phototrophs, and...Ch. 17 - Prob. 3PITCh. 17 - Create a new concept map that includes the...Ch. 17 - Prob. 4PITCh. 17 - Prob. 6PIT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Biology - Intro to Cell Structure - Quick Review!; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=vwAJ8ByQH2U;License: Standard youtube license