BIOLOGY:ESSENTIALS (LL)-W/ACCES>CUSTOM<
3rd Edition
ISBN: 9781264722204
Author: Hoefnagels
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Question
Chapter 17.10, Problem 2MC
Summary Introduction
To determine:
The chordates that have a cranium and are also vertebrates.
Introduction:
The animals are categorized in the phylum Chordata based on the presence of four key characteristics. They are the notochord, dorsal hollow nerve cord, pharyngeal gill slits, and postanal tail. Cephalochordata and Urochordata are the two groups of invertebrates of the phylum Chordata.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 17 Solutions
BIOLOGY:ESSENTIALS (LL)-W/ACCES>CUSTOM<
Ch. 17.1 - Prob. 1MCCh. 17.1 - Prob. 2MCCh. 17.1 - What features were used to build the animal...Ch. 17.1 - Prob. 4MCCh. 17.1 - Prob. 5MCCh. 17.1 - What advantages does segmentation confer?Ch. 17.2 - Prob. 1MCCh. 17.2 - Prob. 2MCCh. 17.2 - Prob. 3MCCh. 17.2 - Prob. 4MC
Ch. 17.3 - Prob. 1MCCh. 17.3 - Prob. 2MCCh. 17.3 - Prob. 3MCCh. 17.3 - Prob. 4MCCh. 17.4 - Prob. 1MCCh. 17.4 - How does the body shape of a flatworm enhance gas...Ch. 17.4 - Prob. 3MCCh. 17.4 - Prob. 4MCCh. 17.5 - Prob. 1MCCh. 17.5 - Prob. 2MCCh. 17.5 - Prob. 3MCCh. 17.6 - What features do all annelids share?Ch. 17.6 - List examples of animals in each of the two...Ch. 17.6 - Prob. 3MCCh. 17.7 - Prob. 1MCCh. 17.7 - Prob. 2MCCh. 17.7 - Prob. 3MCCh. 17.7 - Prob. 4MCCh. 17.8 - Prob. 1MCCh. 17.8 - Prob. 2MCCh. 17.8 - Prob. 3MCCh. 17.8 - Prob. 4MCCh. 17.8 - Prob. 5MCCh. 17.8 - Prob. 6MCCh. 17.9 - What characteristics distinguish the echinoderms?Ch. 17.9 - Prob. 2MCCh. 17.9 - In what ways are echinoderms important?Ch. 17.10 - Prob. 1MCCh. 17.10 - Prob. 2MCCh. 17.10 - Prob. 3MCCh. 17.10 - Prob. 4MCCh. 17.11 - What is the relationship among tunicates,...Ch. 17.11 - Make a table comparing the features of each...Ch. 17.11 - Prob. 3MCCh. 17.11 - Prob. 4MCCh. 17.12 - Prob. 1MCCh. 17.12 - What can skeletal anatomy and DNA sequences in...Ch. 17.12 - What are the four groups of species in the hominin...Ch. 17.12 - Prob. 4MCCh. 17 - Following gastrulation, the cells that have folded...Ch. 17 - Prob. 2MCQCh. 17 - Prob. 3MCQCh. 17 - How is the body structure of an annelid different...Ch. 17 - Prob. 5MCQCh. 17 - Prob. 6MCQCh. 17 - Echinoderms have ____ symmetry as embryos and ____...Ch. 17 - Prob. 8MCQCh. 17 - Which of the following has pharyngeal slits at...Ch. 17 - Lobe-finned fishes are important because they a...Ch. 17 - To which of the following is a salamander most...Ch. 17 - How do reptiles and mammals differ from...Ch. 17 - Which of the following represents the correct...Ch. 17 - Primates share all of the following...Ch. 17 - DNA evidence suggests that modern humans a. share...Ch. 17 - Compare the nine major animal phyla in the order...Ch. 17 - Prob. 2WIOCh. 17 - Using the evolutionary trees in this chapter,...Ch. 17 - Prob. 4WIOCh. 17 - Prob. 5WIOCh. 17 - Prob. 6WIOCh. 17 - Prob. 7WIOCh. 17 - Create lists of animal phyla that a are...Ch. 17 - Prob. 9WIOCh. 17 - Draw from memory a phylogenetic tree that traces...Ch. 17 - Prob. 11WIOCh. 17 - List the evidence that biologists use to classify...Ch. 17 - Prob. 13WIOCh. 17 - Prob. 14WIOCh. 17 - Prob. 15WIOCh. 17 - Prob. 16WIOCh. 17 - Prob. 17WIOCh. 17 - Prob. 18WIOCh. 17 - In what ways has culture been an important factor...Ch. 17 - Prob. 20WIOCh. 17 - How do you predict a scientist would respond to a...Ch. 17 - Prob. 22WIOCh. 17 - Prob. 1SLCh. 17 - Prob. 2SLCh. 17 - Prob. 1PITCh. 17 - Prob. 2PITCh. 17 - Draw a concept map that summarizes the chordates,...Ch. 17 - Add tunicates, hagfishes, birds, monotremes,...Ch. 17 - Other than the ones pictured, give an example of a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning


Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Embryology | Fertilization, Cleavage, Blastulation; Author: Ninja Nerd;https://www.youtube.com/watch?v=8-KF0rnhKTU;License: Standard YouTube License, CC-BY