
Concept explainers
(a)
To determine:
Do the bacteria in the probiotics survive through the mouth, stomach and small and large intestine.
Concept introduction:
Probiotics are live microbes like bacteria and yeast that are taken as supplements to boost ones health. They improve the natural biota of bacteria in the human gut and also improve the functioning of the
(b)
To determine:
Do probiotics promote health.
Concept introduction:
Probiotics are live microbes like bacteria and yeast that are taken as supplements to boost ones health. They improve the natural biota of bacteria in the human gut and also improve the functioning of the digestive system. They are known to improve the immune system too.

Want to see the full answer?
Check out a sample textbook solution
Chapter 17 Solutions
BIOLOGY:CONCEPTS+INVEST.-CONNECT ACCESS
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

