Anatomy & Physiology
1st Edition
ISBN: 9781938168130
Author: Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher: OpenStax College
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 17, Problem 44CTQ
Name the target tissues for prolactin.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 17 Solutions
Anatomy & Physiology
Ch. 17 - Visit this link...Ch. 17 - Visit this link...Ch. 17 - Visit this link...Ch. 17 - Visit this link...Ch. 17 - Visit this link...Ch. 17 - Endocrine glands ________. secrete hormones that...Ch. 17 - Chemical signaling that affects neighboring cells...Ch. 17 - A newly developed pesticide has been observed to...Ch. 17 - A small molecule binds to a G protein, preventing...Ch. 17 - A student is in a car accident, and although not...
Ch. 17 - The hypothalamus is functionally and anatomically...Ch. 17 - Which of the following is an anterior pituitary...Ch. 17 - How many hormones are produced by the posterior...Ch. 17 - Which of the following hormones contributes to the...Ch. 17 - Which of the following statements about the...Ch. 17 - The secretion of thyroid hormones is controlled by...Ch. 17 - The development of a goiter indicates that...Ch. 17 - Iodide ions cross from the bloodstream into...Ch. 17 - When blood calcium levels are low, PTH stimulates...Ch. 17 - Which of the following can result from...Ch. 17 - The adrenal glands are attached superiorly to...Ch. 17 - What secretory cell type is found in the adrenal...Ch. 17 - Cushings disease is a disorder caused by ________....Ch. 17 - Which of the following responses s not part of the...Ch. 17 - What cells secrete melatonin? melanocytes...Ch. 17 - The production of melatonin is inhibited by...Ch. 17 - The gonads produce what class of hormones? amine...Ch. 17 - The production of FSH by the anterior pituitary is...Ch. 17 - The function of the placental hormone human...Ch. 17 - If an autoimmune disorder targets the alpha cells,...Ch. 17 - Which of the following statements about insulin is...Ch. 17 - The walls of the atria produce which hoimone?...Ch. 17 - The end result of the RAAS is to ________. reduce...Ch. 17 - Athletes may take synthetic EPO to boost their...Ch. 17 - Hormones produced by the thymus play a role in the...Ch. 17 - The anterior pituitary gland develops from which...Ch. 17 - In the elderly, decreased thyroid function causes...Ch. 17 - Describe several main differences in the...Ch. 17 - Compare and contrast endocrine and exocrine...Ch. 17 - True or false: Neurotransmitters are a special...Ch. 17 - Compare and contrast the signaling events involved...Ch. 17 - Describe the mechanism of hormone response...Ch. 17 - Compare and contrast the anatomical relationship...Ch. 17 - Name the target tissues for prolactin.Ch. 17 - Explain why maternal iodine deficiency might lead...Ch. 17 - Define hyperthyroidism and explain why one of its...Ch. 17 - Describe the role of negative feedback in the...Ch. 17 - Explain why someone with a parathyroid gland tumor...Ch. 17 - What are the three regions of the adrenal cortex...Ch. 17 - If innervation to the adrenal medulla were...Ch. 17 - Compare and contrast the short-term and long-term...Ch. 17 - Seasonal affective disorder (SAD) is a mood...Ch. 17 - Retinitis pigmentosa (RP) is a disease that causes...Ch. 17 - Compare and contrast the role of estrogens and...Ch. 17 - Describe the role of placental secretion of...Ch. 17 - What would be the physiological consequence of a...Ch. 17 - Why is foot care extremely important for people...Ch. 17 - Summarize the role of GI tract hormones following...Ch. 17 - Compare and contrast the thymus gland in infancy...Ch. 17 - Distinguish between the effects of menopause and...
Additional Science Textbook Solutions
Find more solutions based on key concepts
15. A good scientific hypothesis is based on existing evidence and leads to testable predictions. What hypothes...
Campbell Biology: Concepts & Connections (9th Edition)
1. Why is the quantum-mechanical model of the atom important for understanding chemistry?
Chemistry: Structure and Properties (2nd Edition)
1. ___ Mitosis 2. ___ Meiosis 3. __ Homologous chromosomes 4. __ Crossing over 5. __ Cytokinesis A. Cytoplasmic...
Microbiology with Diseases by Body System (5th Edition)
4. How do gross anatomy and microscopic anatomy differ?
Human Anatomy & Physiology (2nd Edition)
Why is an endospore called a resting structure? Of what advantage is an endospore to a bacterial cell?
Microbiology: An Introduction
4. Three groups of nonvascular plants are _______, ______, and _______. Three groups of seedless vascular plant...
Biology: Life on Earth (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
Great Glands - Your Endocrine System: CrashCourse Biology #33; Author: CrashCourse;https://www.youtube.com/watch?v=WVrlHH14q3o;License: Standard Youtube License