
Laboratory Manual for Hole's Human Anatomy & Physiology Fetal Pig Version
15th Edition
ISBN: 9781260165418
Author: SHIER, David
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Question
Chapter 17, Problem 34CA
Summary Introduction
To determine:
The function of bile salts.
Introduction:
Bile salts functions in the digestion and it is the most found form. Bile salts play an important role for the composition of bile. It causes emulsification and assist the absorption of fats and vitamins.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Chapter 17 Solutions
Laboratory Manual for Hole's Human Anatomy & Physiology Fetal Pig Version
Ch. 17 - Prob. 1PCh. 17 - 2 Which organs constitute the digestive system?
Ch. 17 - 3 Describe the wall of the alimentary canal.
Ch. 17 - Name the types of movements in the alimentary...Ch. 17 - Prob. 5PCh. 17 - Prob. 6PCh. 17 - How does the tongue function as part of the...Ch. 17 - Where are the tonsils located?Ch. 17 - Prob. 9PCh. 17 - How are types of teeth adapted to provide...
Ch. 17 - Prob. 11PCh. 17 - Explain how a tooth is attached to the bone of the...Ch. 17 - Prob. 13PCh. 17 - Prob. 14PCh. 17 - Prob. 15PCh. 17 - Prob. 16PCh. 17 - List the major events of swallowing.Ch. 17 - Prob. 18PCh. 17 - Prob. 19PCh. 17 - Prob. 20PCh. 17 - Why doesn’t the stomach digest itself?Ch. 17 - Prob. 22PCh. 17 - Distinguish among the cephalic, gastric, and...Ch. 17 - Prob. 24PCh. 17 - Prob. 25PCh. 17 - Prob. 26PCh. 17 - Prob. 27PCh. 17 - Prob. 28PCh. 17 - Prob. 29PCh. 17 - List the enzymes in pancreatic juice.Ch. 17 - What are the functions of the enzymes in...Ch. 17 - What regulates secretion of pancreatic juice?Ch. 17 - Locate the liver.Ch. 17 - Review liver functions.Ch. 17 - Prob. 35PCh. 17 - Prob. 36PCh. 17 - Describe the function of the gallbladder.Ch. 17 - How is secretion of bile regulated?Ch. 17 - Prob. 39PCh. 17 - Describe the parts of the small intestine.Ch. 17 - What is the function of an intestinal villus?Ch. 17 - Prob. 42PCh. 17 - Prob. 43PCh. 17 - Prob. 44PCh. 17 - Prob. 45PCh. 17 - Prob. 46PCh. 17 - Prob. 47PCh. 17 - Prob. 48PCh. 17 - Prob. 49PCh. 17 - What stimulus relaxes the ileocecal sphincter?Ch. 17 - Prob. 51PCh. 17 - Prob. 52PCh. 17 - Prob. 53PCh. 17 - Prob. 54PCh. 17 - Prob. 55PCh. 17 - Prob. 56PCh. 17 - Prob. 57PCh. 17 - Prob. 58PCh. 17 - Prob. 59PCh. 17 - Prob. 60PCh. 17 - Prob. 61PCh. 17 - Prob. 1CACh. 17 - Prob. 2CACh. 17 - Prob. 3CACh. 17 - Prob. 4CACh. 17 - Prob. 5CACh. 17 - Prob. 6CACh. 17 - Prob. 7CACh. 17 - Prob. 8CACh. 17 - Prob. 9CACh. 17 - Prob. 10CACh. 17 - Prob. 11CACh. 17 - Prob. 12CACh. 17 - Prob. 13CACh. 17 - Prob. 14CACh. 17 - Describe the locations of the major salivary...Ch. 17 - Prob. 16CACh. 17 - Prob. 17CACh. 17 - Prob. 18CACh. 17 - Prob. 19CACh. 17 - Prob. 20CACh. 17 - Prob. 21CACh. 17 - Prob. 22CACh. 17 - Prob. 23CACh. 17 - Prob. 24CACh. 17 - Prob. 25CACh. 17 - Prob. 26CACh. 17 - Prob. 27CACh. 17 - Prob. 28CACh. 17 - Prob. 29CACh. 17 - Prob. 30CACh. 17 - Prob. 31CACh. 17 - Prob. 32CACh. 17 - Prob. 33CACh. 17 - Prob. 34CACh. 17 - Describe the locations of the parts of the small...Ch. 17 - Prob. 36CACh. 17 - Prob. 37CACh. 17 - Prob. 38CACh. 17 - Prob. 39CACh. 17 - Prob. 40CACh. 17 - Prob. 41CACh. 17 - Prob. 42CACh. 17 - Prob. 43CACh. 17 - Prob. 44CACh. 17 - Prob. 45CACh. 17 - Prob. 46CACh. 17 - Prob. 1IACh. 17 - Prob. 2IACh. 17 - What effect is a before-dinner alcoholic cocktail...Ch. 17 - What type of acid-base imbalance is likely to...Ch. 17 - Prob. 5IA
Knowledge Booster
Similar questions
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education