
Mark the following statements as true or false. If a statement is false, correct it to make a true statement.
a. The heart is located in the mediastinum slightly to the left of the midline.
b. The heart consists of two superior ventricles and two inferior atria.
c. Arteries always carry oxygenated blood away from the heart, and veins always carry deoxygenated blood toward the heart.
d. The pulmonary circuit delivers blood from the right side of the heart to the lungs to become oxygenated.
e. The heart plays a role in the regulation of blood pressure and secretes the hormone atrial natriuretic peptide.

To review:
Whether the following statements are true or false. Also, the false statements are to be corrected.
a. The heart is located in the mediastinum, slightly to the left of the midline.
b. The heart consists of two superior ventricles and two inferior atria.
c. Arteries always carry oxygenated blood away from the heart, and veins always carry deoxygenated blood toward the heart.
d. The pulmonary circuit delivers blood from the right side of the heart to the lungs for it to be oxygenated.
e. The heart plays a role in the regulation of blood pressure and secretes the atrial natriuretic peptide hormone.
Introduction:
The heart is situated on the left side of the thoracic cavity. It consists of four chambers: two atria and two ventricles. Pumping of oxygenated blood away from the heart and carrying deoxygenated blood back is the main function of the heart.
Explanation of Solution
a. The statement,“The heart is located in the mediastinum, slightly to the left of the midline” is true. The mediastinum is a subdivision of the thoracic cavity, located between the two lungs. It not only houses the heart, but also the blood vessels, trachea, andesophagus. The heart lies in the cavity of the mediastinum, and is called the pericardial cavity.
b. The statement, “The heart consists of two superior ventricles and two inferior atria” is false. The heart has four chambers, which include the two ventricles and the two atria. The left and right atria lie superior while the left and right ventricles lie inferior. So, the correct statement is “The heart consists of two superior atria and two inferior ventricles”.
c. The statement, “Arteriesalways carry oxygenated blood away from the heart, and veins always carry deoxygenated blood toward the heart” is true. The pulmonary arteriesare known to carry deoxygenated blood to the lungs for it to be oxygenated, and, in the systemic circuit, arteries deliver oxygenated blood to the systemic capillaries. The veins of the pulmonary circuit deliver oxygenated blood to the left side of the heart, while the veins (of the systemic circuit) deliver deoxygenated blood toward the heart and away from the body.
d. The statement, “The pulmonary circuit delivers blood from the right side of the heart to lungs to become oxygenated” is true. The pulmonary pump is located on the right side of the heart. It pumps blood into a series of blood vessels that directs it to the lungs. The pulmonary arteries deliveroxygen-poor and carbondioxide-rich, or deoxygenated, blood to the lungs to make it oxygenated.
e. The statement, “The heart plays a role in the regulation of blood pressure, and secretes the atrial natriuretic peptide (ANP) hormone” is true. The heart also acts as an endocrine organ. ANP decreases the concentration of sodium ion retention in the kidney and lowers the blood pressure. This reduces the osmotic water retention and also helps in reducing the pressure and volume of blood in the blood vessels.
Thus, it can be concluded that the heart lies in the mediastinum. It consists of two inferior ventricles and two superior atria. Thearteries are responsible for carrying oxygenated blood away from the heartand toward the tissues. Also, veins are responsible for carrying deoxygenated blood towards the heart.
Want to see more full solutions like this?
Chapter 17 Solutions
Human Anatomy & Physiology
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Fundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage Learning


