
Human Anatomy & Physiology, Modified Mastering A&P with eText and Value Pack Access Card and Practicing A&P Workbook for Human Anatomy & Physiology
1st Edition
ISBN: 9780134206189
Author: Erin C. Amerman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 16.1, Problem 3QC
Summary Introduction
To review:
The examples of the secondary endocrine organs and the organs that are neuroendocrine.
Introduction:
The endocrine system comprises the endocrine glandsthatareconsidered as the organs of the system. The glands of the endocrine system are found in various body parts and they have the same function. They regulate homeostasis of the body by secreting hormones.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 16 Solutions
Human Anatomy & Physiology, Modified Mastering A&P with eText and Value Pack Access Card and Practicing A&P Workbook for Human Anatomy & Physiology
Ch. 16.1 - How do the endocrine and nervous systems differ in...Ch. 16.1 - Prob. 2QCCh. 16.1 - Prob. 3QCCh. 16.1 - What are the two major classes of hormones, and...Ch. 16.1 - 5. How do synergistic and antagonistic hormones...Ch. 16.1 - 7. What are the three types of stimuli that...Ch. 16.1 - How is hormone secretion generally regulated?Ch. 16.2 - 1. How do the anterior pituitary and posterior...Ch. 16.2 - What is the hypothalamic-hypophyseal portal...Ch. 16.2 - 3. What are the target tissues and effects of...
Ch. 16.2 - What are the target tissues and effects of...Ch. 16.2 - Which gland produces ADH and oxytocin, and from...Ch. 16.2 - How does the hypothalamus control the secretion of...Ch. 16.2 - 7. What are the tropic hormones of the anterior...Ch. 16.2 - Describe the target tissues and effects of growth...Ch. 16.3 - 1. What are thyroid follicles and how are they...Ch. 16.3 - Prob. 2QCCh. 16.3 - What are the main functions of thyroid hormones?Ch. 16.3 - 4. How are thyroid hormones produced? How is this...Ch. 16.3 - 5. What homeostatic imbalances may accompany...Ch. 16.3 - What are the target tissues and effects of...Ch. 16.3 - Prob. 7QCCh. 16.4 - 1. What are the three zones of the adrenal...Ch. 16.4 - 2. What are the target tissues and effects of...Ch. 16.4 - 3. What are the target tissues and effects of...Ch. 16.4 - What two hormones are produced by the adrenal...Ch. 16.4 - What is the relationship between the adrenal...Ch. 16.5 - What are the main target tissues of glucagon? What...Ch. 16.5 - What are the main target tissues of insulin?Ch. 16.5 - What are the signs and symptoms of the two types...Ch. 16.5 - 4. How do glucagon and insulin work together to...Ch. 16.6 - Prob. 1QCCh. 16.6 - Prob. 2QCCh. 16.6 - Prob. 3QCCh. 16.6 - Prob. 4QCCh. 16.7 - Which hormones primarily control fluid...Ch. 16.7 - 2. What is the role of each of these hormones...Ch. 16.7 - Prob. 3QCCh. 16.7 - Prob. 4QCCh. 16.7 - Prob. 5QCCh. 16.7 - 6. What is the role of each hormone in the stress...Ch. 16 - Mark the following statements as true or false. If...Ch. 16 - Which of the following is not a potential effect...Ch. 16 - 3. Which of the following hormones is/are produced...Ch. 16 - How does ADH affect the amount of water in the...Ch. 16 - Prob. 5CYRCh. 16 - 6. List the target tissues and effects of the...Ch. 16 -
7. The thyroid gland consists of:
a. follicle...Ch. 16 - 8. Which of the following is not an effect of...Ch. 16 - 9. Mark the following statements as true or false....Ch. 16 - 10 Fill in the blanks: A rise in free and would...Ch. 16 - 11. Which of the following statements correctly...Ch. 16 -
12. Fill in the blanks: The outer part of the...Ch. 16 - Which of the following is not an effect of...Ch. 16 - 14. Cortisol is:
a. a potent inhibitor of the...Ch. 16 - 15. Describe the components of the...Ch. 16 - 17. Which of the following statements about the...Ch. 16 - Explain how insulin and glucagon are antagonists.Ch. 16 - Prob. 18CYRCh. 16 - Prob. 19CYRCh. 16 - Match the following hormones with their correct...Ch. 16 - Mark the following statements as true or false. If...Ch. 16 - Predict the effects of a pancreatic tumor that...Ch. 16 - Prob. 2CYUCh. 16 - 3. A patient has a brain tumor that necessitates...Ch. 16 - 1. Ms. Reczkiewicz has her thyroid gland removed...Ch. 16 - A new diet guru claims hypersecretion of cortisol...Ch. 16 - Lets say that the dietary supplement in question 2...Ch. 16 -
4. Mr. Montez is a patient with type I diabetes...Ch. 16 - Prob. 1AYKBCh. 16 - You have read that aldosterone causes sodium ion...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College