
Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 16, Problem 27P
The following is a sequence of the leader region of the his operon mRNA in Salmonella typhimurium. What bases in this sequence could cause a ribosome to pause when histidine is limiting (that is, when there is very little of it) in the medium?
5′AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCA UCCUGACUAGUCUUUCAGGC3′
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Ch.23
How is Salmonella able to cross from the intestines into the blood?
A. it is so small that it can squeeze between intestinal cells
B. it secretes a toxin that induces its uptake into intestinal epithelial cells
C. it secretes enzymes that create perforations in the intestine
D. it can get into the blood only if the bacteria are deposited directly there, that is, through a puncture
—
Which virus is associated with liver cancer?
A. hepatitis A
B. hepatitis B
C. hepatitis C
D. both hepatitis B and C
—
explain your answer thoroughly
Ch.21
What causes patients infected with the yellow fever virus to turn yellow (jaundice)?
A. low blood pressure and anemia
B. excess leukocytes
C. alteration of skin pigments
D. liver damage in final stage of disease
—
What is the advantage for malarial parasites to grow and replicate in red blood cells?
A. able to spread quickly
B. able to avoid immune detection
C. low oxygen environment for growth
D. cooler area of the body for growth
—
Which microbe does not live part of its lifecycle outside humans?
A. Toxoplasma gondii
B. Cytomegalovirus
C. Francisella tularensis
D. Plasmodium falciparum
—
explain your answer thoroughly
Ch.22
Streptococcus pneumoniae has a capsule to protect it from killing by alveolar macrophages, which kill bacteria by…
A. cytokines
B. antibodies
C. complement
D. phagocytosis
—
What fact about the influenza virus allows the dramatic antigenic shift that generates novel strains?
A. very large size
B. enveloped
C. segmented genome
D. over 100 genes
—
explain your answer thoroughly
Chapter 16 Solutions
Genetics: From Genes to Genomes
Ch. 16 - For each of the terms in the left column, choose...Ch. 16 - The following statement occurs early in this...Ch. 16 - One of the main lessons of this chapter is that...Ch. 16 - All mutations that abolish function of the Rho...Ch. 16 - The figure at the beginning of this chapter shows...Ch. 16 - The promoter of an operon is the site to which RNA...Ch. 16 - You are studying an operon containing three genes...Ch. 16 - You have isolated a protein that binds to DNA in...Ch. 16 - You have isolated two different mutants reg1 and...Ch. 16 - Bacteriophage , after infecting a cell, can...
Ch. 16 - Mutants were isolated in which the constitutive...Ch. 16 - Suppose you have six strains of E. coli. One is...Ch. 16 - The previous problem raises some interesting...Ch. 16 - For each of the E. coli strains containing the lac...Ch. 16 - For each of the following growth conditions, what...Ch. 16 - For each of the following mutant E. coli strains,...Ch. 16 - Maltose utilization in E. coli requires the...Ch. 16 - Seven E. coli mutants were isolated. The activity...Ch. 16 - Cells containing missense mutations in the crp...Ch. 16 - Six strains of E.coli mutants 16 that had one of...Ch. 16 - a. The original constitutive operator mutations in...Ch. 16 - In an effort to determine the location of an...Ch. 16 - Prob. 23PCh. 16 - The footprinting experiment described in Fig....Ch. 16 - Why is the trp attenuation mechanism unique to...Ch. 16 - a. How many ribosomes are required at a minimum...Ch. 16 - The following is a sequence of the leader region...Ch. 16 - For each of the E. coli strains that follow,...Ch. 16 - Prob. 29PCh. 16 - For each element in the list that follows,...Ch. 16 - Among the structurally simplest riboswitches are...Ch. 16 - Great variation exists in the mechanisms by which...Ch. 16 - Many genes whose expression is turned on by DNA...Ch. 16 - In 2005, Frederick Blattner and his colleagues...Ch. 16 - The E.coli MalT protein is a positive regulator of...Ch. 16 - Prob. 36PCh. 16 - Prob. 37PCh. 16 - Prob. 38PCh. 16 - Prob. 39PCh. 16 - Prob. 40PCh. 16 - Prob. 41PCh. 16 - The researchers who investigated bioluminescence...Ch. 16 - Prob. 43PCh. 16 - Quorum sensing controls the expression of...Ch. 16 - Scientists are currently screening a chemical...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is this?arrow_forwardMolecular Biology A-C components of the question are corresponding to attached image labeled 1. D component of the question is corresponding to attached image labeled 2. For a eukaryotic mRNA, the sequences is as follows where AUGrepresents the start codon, the yellow is the Kozak sequence and (XXX) just represents any codonfor an amino acid (no stop codons here). G-cap and polyA tail are not shown A. How long is the peptide produced?B. What is the function (a sentence) of the UAA highlighted in blue?C. If the sequence highlighted in blue were changed from UAA to UAG, how would that affecttranslation? D. (1) The sequence highlighted in yellow above is moved to a new position indicated below. Howwould that affect translation? (2) How long would be the protein produced from this new mRNA? Thank youarrow_forwardMolecular Biology Question Explain why the cell doesn’t need 61 tRNAs (one for each codon). Please help. Thank youarrow_forward
- Molecular Biology You discover a disease causing mutation (indicated by the arrow) that alters splicing of its mRNA. This mutation (a base substitution in the splicing sequence) eliminates a 3’ splice site resulting in the inclusion of the second intron (I2) in the final mRNA. We are going to pretend that this intron is short having only 15 nucleotides (most introns are much longer so this is just to make things simple) with the following sequence shown below in bold. The ( ) indicate the reading frames in the exons; the included intron 2 sequences are in bold. A. Would you expected this change to be harmful? ExplainB. If you were to do gene therapy to fix this problem, briefly explain what type of gene therapy youwould use to correct this. Please help. Thank youarrow_forwardMolecular Biology Question Please help. Thank you Explain what is meant by the term “defective virus.” Explain how a defective virus is able to replicate.arrow_forwardMolecular Biology Explain why changing the codon GGG to GGA should not be harmful. Please help . Thank youarrow_forward
- Stage Percent Time in Hours Interphase .60 14.4 Prophase .20 4.8 Metaphase .10 2.4 Anaphase .06 1.44 Telophase .03 .72 Cytukinesis .01 .24 Can you summarize the results in the chart and explain which phases are faster and why the slower ones are slow?arrow_forwardCan you circle a cell in the different stages of mitosis? 1.prophase 2.metaphase 3.anaphase 4.telophase 5.cytokinesisarrow_forwardWhich microbe does not live part of its lifecycle outside humans? A. Toxoplasma gondii B. Cytomegalovirus C. Francisella tularensis D. Plasmodium falciparum explain your answer thoroughly.arrow_forward
- Select all of the following that the ablation (knockout) or ectopoic expression (gain of function) of Hox can contribute to. Another set of wings in the fruit fly, duplication of fingernails, ectopic ears in mice, excess feathers in duck/quail chimeras, and homeosis of segment 2 to jaw in Hox2a mutantsarrow_forwardSelect all of the following that changes in the MC1R gene can lead to: Changes in spots/stripes in lizards, changes in coat coloration in mice, ectopic ear formation in Siberian hamsters, and red hair in humansarrow_forwardPleiotropic genes are genes that (blank) Cause a swapping of organs/structures, are the result of duplicated sets of chromosomes, never produce protein products, and have more than one purpose/functionarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license