
BIO 102 General Biology II Updated Edition (Tidewater Community College)
3rd Edition
ISBN: 9781259614064
Author: Tidewater Community College
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 15, Problem 9MCQ
Summary Introduction
Introduction:
Humans are primate, nested with a group called apes. They differ from other ape in standing and walking upright on two legs (bipedalism).
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 15 Solutions
BIO 102 General Biology II Updated Edition (Tidewater Community College)
Ch. 15.1 - How were conditions on Earth before life began...Ch. 15.1 - Prob. 2MCCh. 15.1 - Prob. 3MCCh. 15.1 - Prob. 4MCCh. 15.2 - How might the endoplasmic reticulum, nuclear...Ch. 15.2 - Prob. 2MCCh. 15.2 - Prob. 3MCCh. 15.3 - Prob. 1MCCh. 15.3 - What types of organisms flourished in the...Ch. 15.3 - How did Palaeozoic life diversify during the...
Ch. 15.3 - Prob. 4MCCh. 15.3 - Prob. 5MCCh. 15.3 - Prob. 6MCCh. 15.4 - Name and describe the three groups of contemporary...Ch. 15.4 - Prob. 2MCCh. 15.4 - Prob. 3MCCh. 15.4 - Prob. 4MCCh. 15.5 - Prob. 1MCCh. 15.5 - Prob. 2MCCh. 15 - Prob. 1MCQCh. 15 - Prob. 2MCQCh. 15 - Photosynthetic cells affected early Earth by a....Ch. 15 - Prob. 4MCQCh. 15 - Prob. 5MCQCh. 15 - Prob. 6MCQCh. 15 - Why was the Mesozoic era extinction significant to...Ch. 15 - Primates share all of the following...Ch. 15 - Prob. 9MCQCh. 15 - DNA evidence suggests that modern humans a. share...Ch. 15 - Explain how the origin of self-replicating...Ch. 15 - Prob. 2WIOCh. 15 - Review the structures of nucleic acids and...Ch. 15 - Prob. 4WIOCh. 15 - The amoeba Pelomyxa palustris is a single-celled...Ch. 15 - Prob. 6WIOCh. 15 - List the major events of the Precambrian supereon...Ch. 15 - Distinguish among the terms primate, hominid,...Ch. 15 - Explain how opposable thumbs, large brains, and...Ch. 15 - Prob. 10WIOCh. 15 - Prob. 11WIOCh. 15 - Use the Internet to learn about National...Ch. 15 - In what ways has culture been an important factor...Ch. 15 - Prob. 14WIOCh. 15 - Compare todays changing culture to biological...Ch. 15 - Prob. 16WIOCh. 15 - Refer to figure 15.31 and the chapter content to...Ch. 15 - Prob. 2PITCh. 15 - Refer to figure 15.31 and the chapter content to...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College


Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
FOSSIL FRIDAY: Primate Evolution | Grades 7-10; Author: Museum of the Rockies;https://www.youtube.com/watch?v=9tVLfvm3AFk;License: Standard YouTube License, CC-BY