ETEXT CAMPBELL BIOLOGY IN FOCUS INSTANT
3rd Edition
ISBN: 9780135964422
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 8TYU
SCIENTIFIC INQUIRY
Imagine you want to study one of the mouse crystallins, proteins present in the lens of the eye. Assuming that the gene has been cloned, describe two ways to study its expression in the embryo.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Would gene chips containing bacterial DNA segments be useful for monitoring gene expression in a mammalian cell?
By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model.
You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos?
You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA?
5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’
3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’
After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…
Homeotic (Hox genes in vertebrates) code for
expression of
that regulate the
OD) Transcription factors, genes that determine segment identity and structure
OC) Poly-A tails, that code for proteins that control muscle differentiation
OE) Transcription factors, genes that control muscle differentiation
OA) Operators, inducible genes coding for enzymes in metabolic pathways
Chapter 15 Solutions
ETEXT CAMPBELL BIOLOGY IN FOCUS INSTANT
Ch. 15.1 - How does binding of the trp corepressor to its...Ch. 15.1 - Describe the binding of RNA polymerase,...Ch. 15.1 - WHAT IF? A certain mutation in E. coli changes the...Ch. 15.2 - Prob. 1CCCh. 15.2 - Compare the roles of general and specific...Ch. 15.2 - Prob. 3CCCh. 15.3 - WHAT IF? Suppose the mRNA being degraded in Figure...Ch. 15.3 - MAKE CONNECTIONS Inactivation of one of the X...Ch. 15.4 - Prob. 1CCCh. 15.4 - WHAT IF? Study the microarray in Figure 15.17. If...
Ch. 15 - If a particular operon encodes enzymes for making...Ch. 15 - The functioning of enhancers is an example of A. a...Ch. 15 - Which of the following is an example of...Ch. 15 - Prob. 4TYUCh. 15 - Prob. 5TYUCh. 15 - Which of the following would not be true of cDNA...Ch. 15 - Prob. 7TYUCh. 15 - SCIENTIFIC INQUIRY Imagine you want to study one...Ch. 15 - FOCUS ON EVOLUTION DNA sequences can act as tape...Ch. 15 - FOCUS ON INTERACTIONS In a short essay (100150...Ch. 15 - Prob. 11TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
The term ‘spore’.
Biology Science Notebook
Some people compare DNA to a blueprint stored in the office of a construction company. Explain how this analogy...
Biology: Concepts and Investigations
Problem Set
True or False? Indicate whether each of the following statements about membrane transport is true (...
Becker's World of the Cell (9th Edition)
Physiology a. deals with the processes or functions of living things. b. is the scientific discipline that inve...
SEELEY'S ANATOMY+PHYSIOLOGY
More than one choice may apply. Using the terms listed below, fill in the blank with the proper term. anterior ...
Essentials of Human Anatomy & Physiology (11th Edition)
Your bore cells, muscle cells, and skin cells look different because a. different kinds of genes are present in...
Campbell Essential Biology (7th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Give typing answer with explanation and conclusionarrow_forwardPlease answer fast Describe how specific molecules are used to change the gene expression of a gene in a cell. Explain if this change in gene expression is beneficial to either the cell or society, using specific examples .arrow_forwardPlease helparrow_forward
- Select all the examples of mutations that are likely to have a global effect on gene expression. Check All That Apply a mutation in a splice donor recognition sequence within an snRNA gene a mutation that reduces expression of an rRNA a hypomorphic mutation in the catalytic site of RNA polymerase a silent mutation in a gene encoding a protein in the small ribosomal subunit a nonsense mutation in a gene encoding an ion channelarrow_forwardCreate a Venn diagram to compare and contrast the process of gene expression in Bacteria versus eukaryotes. Remember that “gene expression” can include any part of transcription or translation. Try to be as thorough as you can about what aspects of this process are similar between the two taxa, and what characteristics are distinct to only Bacteria or eukaryotes. Plase include a minimum of 15 items in the Venn diagram.arrow_forwardDiscuss in your own wordings the concept of gene expression. proper explanation and diagramarrow_forward
- The sequencing of entire genomes has made it possible to examine the level of gene expression in a particular cell or tissue by using oligonucleotide probes to assess the mRNA expression level from a particular gene. This is done most effectively through the use of what experimental technique?arrow_forwardGene expression can be controlled with the help of RNA.Explain the method with an example.arrow_forwardWhat strategy does a genetically encoded calcium indicator look like to allow fluorescence imaging of only one cell type in an acute slice of the brain? A.The use of fluorescent protein expression inhibitors in other cells B.The injection of a recombinant virus causing the death of other cells C.The use of a promoter specific to these cells D.Activation of membrane receptors specific to these cellsarrow_forward
- You are a research scientist working in genetic engineering. You create a piece of DNA that you want to express in a mouse cell, which is a eukaryote. This piece of DNA (represented by the schematic in the figure) consists of a eukaryotic promoter, a prokaryotic gene lacking introns and exons and a eukaryotic terminator sequence. Do you think that this piece of DNA would be successfully expressed if placed into a mouse cell containing all the machinery needed for gene expression? Fully motivate your answer. The AAUAAA Eukaryotic Start Coding Stop terminator promoter codon sequence codon sequencearrow_forwardSuppose you had funding to do a genome-wide gene expression experiment (20,000 genes). You can use a total of 20 RNA samples. Briefly describe the experiment you would run. In the context of your experiment, what is a false positive? In the context of your experiment, what is a false negativearrow_forwardYou are curious to identify the region of the gene X sequence that serves as an enhancer for gene expression. Design an experiment to investigate this issue.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY