Concept explainers
Which of the following is not a property of DNA polymerase?
a. It adds dNTPs only in the 5' → 3' direction.
b. It requires a primer to work.
c. It is associated with a sliding clamp only on the leading strand.
d. Its exonuclease activity is involved in proofreading.

Introduction:
DNA (deoxyribonucleic acid) polymerase is the enzyme responsible for the replication of DNA. The enzymes incorporate the deoxyribonucleotides (dNTPs) into the newly synthesizing DNA molecule from the template DNA. The sliding clamp acts as a processivity promoter factor in the DNA replication. It is crucial for DNA polymerase binding to the template DNA as it prevents the frequent dissociation of the DNA polymerase from the template DNA.
Answer to Problem 1TYK
Correct answer:
The association with the sliding clamp only on the leading strand is not the property of DNA polymerase.
Explanation of Solution
Explanation/Justification for the correct answer:
Option (c) is given as association of DNA polymerase only with sliding clamp on the leading strand. The DNA polymerase is associated with the sliding clamp protein in the leading as well as with the lagging strand. Hence, the Option (c) is correct.
Explanation for incorrect answers:
Option (a) is given as adding of dNTPs only in the 5’→3’ direction. The DNA polymerase adds the dNTPs on the growing end in the 5’→3’ direction. So, it is an incorrect option.
Option (b) is given as primer is needed for DNA polymerase. The primer is an oligonucleotide (short stretch of DNA or RNA [ribonucleic acid]) and is required for the synthesis of DNA using DNA polymerase. So, it is an incorrect option.
Option (d) is given as proofreading is associated with exonuclease activity of DNA polymerase. The enzyme also has an exonuclease activity for proofreading of newly synthesized DNA. These are the property of DNA polymerase. So, it is an incorrect option.
Hence, the options (a), (b), and (d) are incorrect.
DNA polymerase catalyzes the addition of dNTPs in the 5’→3’ direction, it requires a primer for initiation of DNA replication, it has exonuclease proofreading activity, and is associated with sliding clamp on both the leading and lagging strand of DNA.
Want to see more full solutions like this?
Chapter 15 Solutions
Biological Science (7th Edition)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage




