Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
3rd Edition
ISBN: 9780135564172
Author: Mark Sanders, John Bowman
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 11P
Injection of double-stranded RNA can lead to gene silencing by degradation of RNA molecules complementary to either strand of the dsRNA. Could RNAi (see Sections
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Explain how site directed mutagenesis can be accomplished using M13 bacteriophage. Using this method often results in only 5% of plaques with mutant gene. Explain how the procedure has been modified to enrich for the number of plaques with the mutant gene.
Several common antibiotics affect some strains of bacteria's ability to carry out transcription and/or translation. For example:
Rifamycin inhibits prokaryotic RNA polymerase
Chloramphenicol blocks the transfer of the peptide from the P to A site.
a) For each of these drugs, identify at what point it could affect the process of DNA->RNA->protein. Be as specific as possible.
b) Why do you think these drugs kill bacteria but spare animal cells? (Hint: remember bacteria are prokaryotes)
Gene expression can be disrupted by techniques such as homologous recombination and RNA interference. What is the functional difference between these two methods in terms of the ultimate effect on gene expression? Why might homologous recombination or an alternative genome-editing method (e.g., CRISPR/Cas9) be preferred over RNA interference?
Chapter 15 Solutions
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
Ch. 15 - 15.1 What purpose do the bla and lacZ genes serve...Ch. 15 - The human genome is 3109 bp in length. How many...Ch. 15 - 15.3 Ligase catalyzes a reaction between the...Ch. 15 - You have constructed four different libraries: a...Ch. 15 - Using the genomic libraries in Problem 4, you wish...Ch. 15 - The human genome is 3109bp. You wish to design a...Ch. 15 - 15.7 Using animal models of human diseases can...Ch. 15 - 15.8 Compare methods for constructing homologous...Ch. 15 - 15.9 Chimeric genefusion products can be used for...Ch. 15 - 15.10 Why are diseases of the blood simpler...
Ch. 15 - Injection of double-stranded RNA can lead to gene...Ch. 15 - Compare and contrast methods for making transgenic...Ch. 15 - 15.13 It is often desirable to insert cDNAs into a...Ch. 15 - 15.14 A major advance in the s was the development...Ch. 15 - 15.15 The bacteriophage lambda genome can exist in...Ch. 15 - 15.16 The restriction enzymes Xho and Sal cut...Ch. 15 - 15.17 The bacteriophage has a single-stranded DNA...Ch. 15 - 15.18 To further analyze the CRABS CLAW gene (see...Ch. 15 - You have isolated a genomic clone with an EcoR I...Ch. 15 - 15.20 You have identified a cDNA clone that...Ch. 15 - 15.21 You have isolated another cDNA clone of the...Ch. 15 - 15.22 You have identified five genes in S....Ch. 15 - You have generated three transgenic lines of maize...Ch. 15 - 15.24 Bacterial Pseudomonas species often possess...Ch. 15 - 15.25 Two complaints about some transgenic plants...Ch. 15 - 15.26 In Drosophila, lossoffunction Ultrabithorax...Ch. 15 - Prob. 27PCh. 15 - The highlighted sequence shown below is the one...Ch. 15 - Vitamin E is the name for a set of chemically...Ch. 15 - The RAS gene encodes a signaling protein that...Ch. 15 - 15.31 You have cloned a gene for an enzyme that...Ch. 15 - 15.32 About of occurrences of nonautoimmune type...Ch. 15 - Describe how having the Cas 9 gene at a genomic...Ch. 15 - 15.34 Would a gene drive system spread rapidly...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Fill in the Table Broad Topic: Specific Topic: What is known: Experimental Question: Panel Technique These data show: Figure 1 A B Carrow_forwardThe most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant. The TATA box and kozak sequences are in parenthesis. What type of mutation is present? Wild-type:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ Mutant:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGC AGAGCATACTGAGGGTAGTAG-3’ Answer: Is this a transition mutation? because there is an exchange of G instead of A? It kind of confuses me a little. helparrow_forward1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also charged methionine tRNAs with alanine? b)What would happen if an individual was homozygous for mutant alleles of the gene encoding the aminoacyl tRNA synthetase responsible for charging leucine tRNAs?arrow_forward
- a. Some antibiotics, such as rifampin, interfere with the function of RNA polymerase. What biological process is rifampin disrupting? b. Some antibiotic-resistant M. tuberculosis bacteria have a single point mutation (CàT) in the rpoB gene that causes an amino acid change from serine (a polar amino acid) to leucine (a non-polar amino acid). What type of mutation is this? Do you expect this to have no effect, a small effect, or a large effect on the polypeptide produced? Explain your reasoning. c. The rpoB gene encodes a subunit of the bacterial RNA polymerase protein. The point mutation described in Question 2 causes a change in protein folding, which leads to the inability of the rifampin antibiotic to bind to the RNA polymerase. Which level(s) of protein structure is/are affected by this change?arrow_forwardDescribe what would happen to the lac operon in a low-lactose environment and in a high lactose environment. a) How will each of these environments affect gene expression? b) What would happen to the repressor in each case? c) How will each of these environments affect RNA polymerase?arrow_forwardNonearrow_forward
- Prior to the publication of the article from which this assay comes from (picture), the Cas9 endonuclease was known to be involved in CRISP RNA (crRNA) maturation, but the mechanism by which Cas9 participates in targeted DNA disruption was unknown. To test whether and how Cas9 might be able to target DNA cleavage, researchers developed an in vitro assay. One of the first steps was to purify the Cas9 protein from Streptococcus pyogenes and several orthologs. The description of the figure states: SDS-PAGE analysis of purified Cas9 orthologs. Cas9 orthologs were purified as described in Supplementary Materials and Methods. 2.5 ug of each purified Cas9 were analyzed on a 4-20% gradient polyacrylamide gel and stained with SimplyBlue Safe Stain. Answer the following questions based on this information and the figure. a. Results: Explain the data in terms of observations and patterns. b. Conclusion: Describe how the data support or not support the hypothesis. c. Briefly describe a next…arrow_forwardThe ability to selectively modify the genome in the mouse has revolutionized mouse genetics. Outline the procedure for generating a knockout mouse at a specific genetic locus. How can the loxP-Cre system be used to conditionally knock out a gene? What is an important medical application of knockout mice?arrow_forwardWhat type of RNAi silencing targets DNA? What mechanism does this type of RNAi use? Group of answer choices siRNA; results in methylation of DNA miRNA; results in methylation of the DNA siRNA; results in degradation of DNA asRNA; results in degradation of the DNA asRNA; results in methylation of the DNA miRNA; results in degradation of the DNAarrow_forward
- Prior to the publication of the article from which this assay comes from (picture), the Cas9 endonuclease was known to be involved in CRISPR RNA (crRNA) maturation, but the mechanism by which Cas9 participates in targeted DNA disruption was unknown. To test whether and how Cas9 might be able to target DNA cleavage, researchers developed an in vitro assay. One of the first steps was to purify the Cas9 protein from Streptococcus pyogenes and several orthologs. The description of the figure states: SDS-PAGE analysis of purified Cas9 orthologs. Cas9 orthologs were purified as described in Supplementary Materials and Methods. 2.5 ug of each purified Cas9 were analyzed on a 4-20% gradient polyacrylamide gel and stained with SimplyBlue Safe Stain. Answer the following questions based on this information and the figure. a. What is the experimental/research question and state a hypothesis related to this question. b. What is the approach of the figure and provide a description of techniques…arrow_forwardFor the given mutation below,please write down the reverse mutation and any intragenic suppressor mutations for that mutation. Use the codon table for amino acids as reference. In this case, mutation means single letter change. Mutation: AGA -> AGC Arg codons: CGU, CGC, CGA, CGG,AGA,ACG Ser codons: UCU, UCC, UCA, UCG, AGU, AGC Character limit is 10 characters. Write down Reverse mutation sequence first and then intragenic suppressor mutation sequence. Write down the mutated sequence not the mutation.arrow_forwardArrange the steps that would be used in a laboratory to engineer a bacterium that could express the human gene coding for factor VIII. (Not all steps will be placed).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY