Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14.20, Problem 1MQ
How can homo- and heterofermentative
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 14 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 14.1 - What is the fundamental difference between an...Ch. 14.1 - What is the purpose of chlorophyll and...Ch. 14.1 - Why can phototrophic green bacteria grow at light...Ch. 14.1 - What are the functions of light-harvesting and...Ch. 14.2 - In which phototrophs are carotenoids found?...Ch. 14.2 - How does the structure of a phycobilin compare...Ch. 14.2 - Phycocyanin is blue-green. What color of light...Ch. 14.2 - What accessory pigments are present in...Ch. 14.3 - What parallels exist in the processes of...Ch. 14.3 - What is reverse electron flow and why is it...
Ch. 14.3 - What is the difference between cyclic and...Ch. 14.3 - What is reverse electron transport and why is it...Ch. 14.4 - Differentiate between cyclic and noncyclic...Ch. 14.4 - What is the key role of light energy in the...Ch. 14.4 - What evidence is there that anoxygenic and...Ch. 14.4 - Prob. 1CRCh. 14.5 - Prob. 1MQCh. 14.5 - How much NADPH and ATP is required to make one...Ch. 14.5 - Contrast autotrophy in the following phototrophs:...Ch. 14.5 - QWhat is a carboxysome, and what is its role in...Ch. 14.6 - Prob. 1MQCh. 14.6 - What is FeMo-co and what does it do?Ch. 14.6 - How is acetylene useful in studies of nitrogen...Ch. 14.6 - How might the ability to fix nitrogen help a...Ch. 14.7 - In a coupled reaction, how can you tell the...Ch. 14.7 - How does aerobic respiration differ from anaerobic...Ch. 14.7 - Describe the major differences between...Ch. 14.7 - Prob. 1CRCh. 14.8 - What enzyme is required for hydrogen bacteria to...Ch. 14.8 - Why is reverse electron flow unnecessary in H2...Ch. 14.8 - QWhich inorganic electron donors are used by the...Ch. 14.9 - Prob. 1MQCh. 14.9 - In terms of intermediates, how does the Sox system...Ch. 14.9 - Prob. 1CRCh. 14.10 - Prob. 1MQCh. 14.10 - What is the function of rusticyanin and where is...Ch. 14.10 - How can Fe2+ be oxidized under anoxic conditions?Ch. 14.10 - Prob. 1CRCh. 14.11 - Prob. 1MQCh. 14.11 - Prob. 2MQCh. 14.11 - Prob. 1CRCh. 14.12 - What are the electron donor and acceptor in the...Ch. 14.12 - What does electron transport in anammox bacteria...Ch. 14.12 - Compare CO2 fixation in anammox bacteria and...Ch. 14.12 - Prob. 1CRCh. 14.13 - For Escherichia coli, why is more energy released...Ch. 14.13 - How do the products of NO3 reduction differ...Ch. 14.13 - Where is the dissimilative nitrate reductase found...Ch. 14.13 - Prob. 1CRCh. 14.14 - How is SO42 converted to SO32 during dissimilative...Ch. 14.14 - Contrast the growth of Desulfovibrio on H2 versus...Ch. 14.14 - Give an example of sulfur disproportionation.Ch. 14.14 - Prob. 1CRCh. 14.15 - Prob. 1MQCh. 14.15 - What is reductive dechlorination and why is it...Ch. 14.15 - How does anaerobic glucose catabolism differ in...Ch. 14.15 - Compare and contrast ferric iron reduction with...Ch. 14.16 - What is the purpose of CO dehydrogenase?Ch. 14.16 - If acetogens conserve energy using the Rnf...Ch. 14.16 - What is electron bifurcation and what role does it...Ch. 14.16 - Compare and contrast acetogens with methanogens in...Ch. 14.17 - Which coenzymes function as C1 carriers in...Ch. 14.17 - In methanogens growing on H2 + CO2, how is carbon...Ch. 14.17 - How is ATP made in methanogenesis when the...Ch. 14.17 - What are the major differences in the conservation...Ch. 14.18 - When using CH4 as electron donor, why is...Ch. 14.18 - In which two ways does the ribulose monophosphate...Ch. 14.18 - What is unique about methanotrophy in...Ch. 14.18 - Prob. 1CRCh. 14.19 - Why is H2 produced during many types of...Ch. 14.19 - Why is acetate formation in fermentation...Ch. 14.19 - Define the term substrate-level phosphorylation:...Ch. 14.20 - How can homo- and heterofermentative metabolism be...Ch. 14.20 - Butanediol production leads to greater ethanol...Ch. 14.20 - QWhat are the major fermentation products of...Ch. 14.21 - Compare the mechanisms for energy conservation in...Ch. 14.21 - What type of substrates are fermented by...Ch. 14.21 - What are the substrates for the Clostridium...Ch. 14.21 - Prob. 1CRCh. 14.22 - Why does Propionigenium modestum require sodium...Ch. 14.22 - Of what benefit is the organism Oxalobacter to...Ch. 14.22 - Prob. 3MQCh. 14.22 - Give an example of a fermentation that does not...Ch. 14.23 - Give an example of interspecies H2 transfer. Why...Ch. 14.23 - Why can a pure culture of Syntrophomonas grow on...Ch. 14.23 - Why is syntrophy also called interspecies H2...Ch. 14.24 - How do monooxygenases differ in function from...Ch. 14.24 - What is the final product of catabolism of a...Ch. 14.24 - Prob. 3MQCh. 14.24 - How do monooxygenases differ from dioxygenases in...Ch. 14.25 - What is the benzoyl-CoA pathway, and how might it...Ch. 14.25 - How is hexane oxygenated during anoxic catabolism?Ch. 14.25 - Prob. 1CRCh. 14 - The growth rate of the phototrophic purple...Ch. 14 - Prob. 2AQCh. 14 - A fatty acid such as butyrate cannot be fermented...Ch. 14 - When methane is made from CO2 (plus H2) or from...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
cell culture and growth media for Microbiology; Author: Scientist Cindy;https://www.youtube.com/watch?v=EjnQ3peWRek;License: Standard YouTube License, CC-BY