ANATOMY & PHYSIOLOGY (LL) W/ CONNECT
9th Edition
ISBN: 9781265884185
Author: SALADIN
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Question
Chapter 14, Problem 8WWTS
Summary Introduction
Introduction:
Cranial nerves are used to communicate to all parts of the body from the brain. There are twelve types, 1 to 12 cranial nerves are present in our body. All cranial nerves enter the brain through the spinal cord. Each nerve has a distinctive function and specific name.
Most of the cranial nerves arise from the brain stem and control the muscle in head and neck, and the largest one that controls the facial muscles is the trigeminal nerve.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 14 Solutions
ANATOMY & PHYSIOLOGY (LL) W/ CONNECT
Ch. 14.1 - Prob. 1BYGOCh. 14.1 - Define gyrus and sulcus.Ch. 14.1 - Prob. 3BYGOCh. 14.1 - Prob. 4BYGOCh. 14.1 - Prob. 1AYLOCh. 14.1 - Prob. 2AYLOCh. 14.1 - Prob. 3AYLOCh. 14.1 - Prob. 4AYLOCh. 14.1 - Prob. 5AYLOCh. 14.1 - Embryonic development of the brain from neural...
Ch. 14.2 - Prob. 5BYGOCh. 14.2 - Prob. 6BYGOCh. 14.2 - Prob. 7BYGOCh. 14.2 - Prob. 8BYGOCh. 14.2 - Prob. 1AYLOCh. 14.2 - Prob. 2AYLOCh. 14.2 - Prob. 3AYLOCh. 14.2 - Prob. 4AYLOCh. 14.2 - Prob. 5AYLOCh. 14.2 - Prob. 6AYLOCh. 14.2 - Prob. 7AYLOCh. 14.3 - Prob. 9BYGOCh. 14.3 - Prob. 10BYGOCh. 14.3 - Prob. 11BYGOCh. 14.3 - Prob. 12BYGOCh. 14.3 - Prob. 13BYGOCh. 14.3 - The medulla oblongata: its location, gross...Ch. 14.3 - Prob. 2AYLOCh. 14.3 - Prob. 3AYLOCh. 14.3 - Prob. 4AYLOCh. 14.3 - The cerebellum: its location, gross anatomy,...Ch. 14.3 - Prob. 6AYLOCh. 14.4 - Prob. 14BYGOCh. 14.4 - Prob. 15BYGOCh. 14.4 - List at least six functions of the hypothalamus.Ch. 14.4 - Prob. 17BYGOCh. 14.4 - Distinguish between commissural, association, and...Ch. 14.4 - Prob. 19BYGOCh. 14.4 - Prob. 20BYGOCh. 14.4 - Prob. 1AYLOCh. 14.4 - Prob. 2AYLOCh. 14.4 - Prob. 3AYLOCh. 14.4 - Prob. 4AYLOCh. 14.4 - Prob. 5AYLOCh. 14.4 - Prob. 6AYLOCh. 14.4 - Prob. 7AYLOCh. 14.4 - Prob. 8AYLOCh. 14.4 - Prob. 9AYLOCh. 14.4 - Prob. 10AYLOCh. 14.4 - Prob. 11AYLOCh. 14.4 - Prob. 12AYLOCh. 14.4 - Prob. 13AYLOCh. 14.5 - Prob. 21BYGOCh. 14.5 - Prob. 22BYGOCh. 14.5 - Prob. 23BYGOCh. 14.5 - Prob. 24BYGOCh. 14.5 - Prob. 1AYLOCh. 14.5 - Stages of sleep; physiological characteristics of...Ch. 14.5 - Association areas of the cerebral cortex; the...Ch. 14.5 - Prob. 4AYLOCh. 14.5 - Prob. 5AYLOCh. 14.5 - Prob. 6AYLOCh. 14.5 - Prob. 7AYLOCh. 14.5 - Prob. 8AYLOCh. 14.5 - Prob. 9AYLOCh. 14.5 - Prob. 10AYLOCh. 14.5 - Prob. 11AYLOCh. 14.5 - Effect of Parkinson disease and basal nuclei...Ch. 14.5 - Prob. 13AYLOCh. 14.5 - Prob. 14AYLOCh. 14.6 - Prob. 25BYGOCh. 14.6 - Prob. 26BYGOCh. 14.6 - Prob. 27BYGOCh. 14.6 - Prob. 28BYGOCh. 14.6 - Prob. 29BYGOCh. 14.6 - Prob. 1AYLOCh. 14.6 - Prob. 2AYLOCh. 14.6 - Prob. 3AYLOCh. 14.6 - Prob. 4AYLOCh. 14 - Which of these is caudal to the hypothalamus? a....Ch. 14 - If the telencephalon was removed from a 5-week-old...Ch. 14 - The blood-CSF barrier is formed by a. blood...Ch. 14 - Prob. 4TYRCh. 14 - Which of the following does not receive any input...Ch. 14 - Prob. 6TYRCh. 14 - Prob. 7TYRCh. 14 - The_________is most closely associated with the...Ch. 14 - Prob. 9TYRCh. 14 - Prob. 10TYRCh. 14 - The right and left cerebral hemispheres are...Ch. 14 - Prob. 12TYRCh. 14 - Prob. 13TYRCh. 14 - Prob. 14TYRCh. 14 - Prob. 15TYRCh. 14 - Prob. 16TYRCh. 14 - Prob. 17TYRCh. 14 - Prob. 18TYRCh. 14 - Prob. 19TYRCh. 14 - Prob. 20TYRCh. 14 - Prob. 1BYMVCh. 14 - Prob. 2BYMVCh. 14 - Prob. 3BYMVCh. 14 - Prob. 4BYMVCh. 14 - Prob. 5BYMVCh. 14 - Prob. 6BYMVCh. 14 - Prob. 7BYMVCh. 14 - oculo-Ch. 14 - Prob. 9BYMVCh. 14 - Prob. 10BYMVCh. 14 - Prob. 1WWTSCh. 14 - Prob. 2WWTSCh. 14 - Prob. 3WWTSCh. 14 - Prob. 4WWTSCh. 14 - Prob. 5WWTSCh. 14 - Prob. 6WWTSCh. 14 - Prob. 7WWTSCh. 14 - Prob. 8WWTSCh. 14 - Prob. 9WWTSCh. 14 - Prob. 10WWTSCh. 14 - Prob. 1TYCCh. 14 - Prob. 2TYCCh. 14 - Suppose that a neuroanatomist performed two...Ch. 14 - A person can survive destruction of an entire...Ch. 14 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:Cengage
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningUnderstanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage
Nervous System - Get to know our nervous system a bit closer, how does it works? | Neurology; Author: FreeMedEducation;https://www.youtube.com/watch?v=6O-0CVAgaEM;License: Standard youtube license