Biology
4th Edition
ISBN: 9781259188121
Author: Peter Stiling, Robert Brooker, Linda Graham, Eric Widmaier
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 14, Problem 7TY
Xeroderma pigmentosum
- a. is a genetic disorder that results in uncontrolled cell growth.
- b. is a genetic disorder in which the NER system is not fully functional.
- c. is a genetic disorder that results in the loss of pigment in certain patches of skin.
- d. results from the lack of DNA polymerase proofreading.
- e. both b and d are true of this disorder.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
which of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply
a. Thread-like blood vessels in eyes
b. Excessive bleeding
c. Dwarfism
d. UV light sensitivity
e. sunburn
f. Bruises
Which of the following are characteristics of aging cells (select all that apply)?
A.
Chronic inflammation results in premature shortening of telomeres
B.
Lengthening of telomeric DNA sequence
C.
Accumulation of telomere-dysfunction–induced foci (TIFs)
D.
Older cells produce more telomerase
E.
Increased erosion of telomeres
Which of the following statements regarding loss of function and gain of function mutations is true? 
A. If both gain of function and loss of function approaches show the consistent results it is the most convincing evidence to demonstrate the function of gene
B. Gain of  function mute tapes are the most of case recessive
C. Gain of function approach is more convincing than loss of function approach
D. Over expression of a gene cannot be considered as gain of function
Chapter 14 Solutions
Biology
Ch. 14.1 - Consequences of Mutations Concept Check: Based on...Ch. 14.1 - Prob. 2CCCh. 14.1 - Prob. 3CCCh. 14.2 - Prob. 1EQCh. 14.2 - Prob. 2EQCh. 14.2 - Prob. 3EQCh. 14.2 - Prob. 1CCCh. 14.2 - Prob. 2CCCh. 14.3 - DNA Repair Concept Check: Which components of the...Ch. 14.3 - Why is this person so sensitive to sunlight?...
Ch. 14.4 - Prob. 1CCCh. 14.4 - Prob. 1BCCh. 14.4 - Prob. 2CCCh. 14.4 - Prob. 3CCCh. 14.4 - Prob. 4CCCh. 14 - Prob. 1TYCh. 14 - Prob. 2TYCh. 14 - Prob. 3TYCh. 14 - Prob. 4TYCh. 14 - Prob. 5TYCh. 14 - The Ames test a. provides a way to determine if...Ch. 14 - Xeroderma pigmentosum a. is a genetic disorder...Ch. 14 - Prob. 8TYCh. 14 - Prob. 9TYCh. 14 - Prob. 10TYCh. 14 - Prob. 1CQCh. 14 - Prob. 2CQCh. 14 - Prob. 3CQCh. 14 - Prob. 1COQCh. 14 - Distinguish between spontaneous and induced...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Police Captain Jeffers has suffered a myocardial infarction. a. Explain to his (nonmedically oriented) family w...
Human Physiology: An Integrated Approach (8th Edition)
Why are mutants used as test organisms in the Ames test?
Laboratory Experiments in Microbiology (11th Edition)
Jellyfish Lake, located on the Pacific island of Palau, is home to millions of jellyfish. Many years ago, sea l...
BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
Figure 11.6 Label the features of the skin.
Laboratory Manual For Human Anatomy & Physiology
Why do scientists think that all forms of life on earth have a common origin?
Genetics: From Genes to Genomes, 5th edition
Relative thickness of the myocardium in different chambers; the functional significance of those differences; a...
Anatomy & Physiology: The Unity of Form and Function
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following is NOT common to all repair mechanisms? A. Detection of the lesion B. Removal of the damaged DNA sequence/ nucleotide/ base C. Removal of free radicals at the site of injury D. Repair of the lesion E. Involvement of enzymes in removing the lesion and/or repair of the damaged sequence/nucleotide/base.arrow_forwardWhich of the following methods might have a clue whether child suffering from genetic disease a was missing a large chunk of the jean that one defective caused the genetic disorder?arrow_forwardThe BRCA genes produce DNA repair proteins. Genetic testing is available that can determine if a person has a mutation in the BRCA genes that makes the proteins less able to function. What is the result of a BRCA mutation? A. The person is more likely to develop cancer if other DNA in the cell mutates. B. The person is less likely to develop cancer unless the BRCA region is methylated. C. The person is less likely to develop cancer because the BRCA gene will inhibit the cell cycle checkpoints. D. The person is more likely to develop cancer because the BRCA gene promotes an increased rate for mitosis.arrow_forward
- For gain-of-function disorders, which of the following treatment strategies is the be . A. Gene augmentation B.Supply healthy cells . C.Supply normal form of proteins encoded by wild-type allele . D. Gene silencingarrow_forwardIn general, all mutations can be considered harmful, because most genetic systems are already optimized to work correctly and efficiently. A. True b. False; mutations are considered harmful only if they have a direct effect on the ability of cells to synthesize DNA c. False; some mutations are harmful, and some are considered beneficialarrow_forwardA.) There is no change in the DNA sequence if nucleotides are added or removed, it will have no effect to the cell. B.) Mutations in the DNA sequence are all irreversible. A. Statement A is correct B. Statement B is correct C. Both A and B are correct D. Both A and B are incorrectarrow_forward
- Which of the following terms refer to the case when a mutation results in a significant decrease or a complete loss of the functional activity of a gene product? a. gain-of-function mutation b. loss-of-function mutationarrow_forwardA.) DNA encodes for the cell genome and is therefore a permanent copy to have a functioning cell. B.)Different changes to the structure of messenger RNA can cause mutations and genomic instability which could lead to abnormal cells in the body. a. Statement A is correct b. Statement B is correct c. Both A and B are correct d. Both A and B are incorrectarrow_forwardA medical research firm developed a new test for bipolar disorder that tries to identify if specific series of genome codes are missing in a person's DNA. What is the focus of the firm's test? Select one: a. chorionic villus samples Incorrect b. copy number variations c. diathesis-stress markers d. autosomal mutationsarrow_forward
- When using gene therapy to treat an hereditary disease, the idea is to: A. Introduce the correct gene into the patient's DNA B. Inject the patient with a specific protein to cure the disease. C. Blood transfusions from healthy individuals. D. ntroduce mRNA molecules with the correct genetic information to the patient. E. Introduce a virus to the patient that will specifically destroy mutated cells.arrow_forwardThe BRCA genes produce DNA repair proteins. Genetic testing is available that can determine if a person has a mutation in the BRCA genes that makes the proteins less able to function. What is the result of a BRCA mutation? A. The person is more likely to develop cancer if other DNA in the cell mutates. O B. The person is less likely to develop cancer unless the BRCA region is methylated. O C. The person is less likely to develop cancer because the BCA gene will inhibit the cell cycle checkpoints. D. The person is more likely to develop cancer because the BRCA gene promotes an increased rate for mitosis. swered MacBool F1 F2 F3 D00 F4 F5 F6 F7 F8 $ % & * 2 云 # 3arrow_forwardFrom the list of answers below (A-D) select the correct answer(s). There may be more than one correct answer. B. Identical twins have the same genome, as well as the same epigenome. C. Epigenetic changes can be introduced or changed by social experience. D. Epigenetic changes are permanent and once acquired can never be changed. A. Identical twins have the same genome, but may have different epigenomes.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Cancer Types SIMPLY explained! MEMORIZE them QUICKLY and EASILY!; Author: CancerEdInstitute;https://www.youtube.com/watch?v=dEBi-yvSWmQ;License: Standard Youtube License