Mechanism of expression of genes is regulated by various types of gene products. These genes can be switched on or off during the course of gene expression. Some genes express continuously, while some express only at the time of need of their expression.

Question

Want to see more full solutions like this?

Answer 1

Question

Chapter 14, Problem 1TY

Summary Introduction

Introduction: Mechanism of expression of genes is regulated by various types of gene products. These genes can be switched on or off during the course of gene expression. Some genes express continuously, while some express only at the time of need of their expression.

Expert Solution & Answer

Answer to Problem 1TY

Correct answer: Genes that are expressed at all time constantly are called constitutive genes. Hence, the correct answer is option d.

Explanation of Solution

Reason for correct answer:

Constitutive genes are those genes which express at constant levels at all time. Products of such genes regulate processes associated with biochemical activities of cells.

Option d. is given as “constitutive”.

Constitutive genes are special genes that are expressed at constant levels at every time for effective regulation of gene expression process. Hence, the correct answer is option d.

Reasons for incorrect answer:

Option a. is given as, “inducible”.

Inducible genes are genes whose activity is controlled by the external factors. These genes are not expressed all the times in the cell. Hence, option a. is incorrect.

Option b. is given as, “repressible”.

Repressible genes are genes whose activity is affected at the time of higher concentration of products. High product concentration represses these genes to maintain constant level of products in the cell. These genes are not expressed at all time at constant levels in the cell. Hence, option b. is incorrect.

Option c. is given as, “positive”.

No positive genes are associated with the gene regulation process. Hence, option c. is incorrect.

Option e. is given as, “negative”.

No negative genes are associated with the gene regulation and expression mechanisms. Hence, option e. is incorrect.

Hence, the options a., b. ,c., and e. are incorrect.

Conclusion

Constitutive genes express continuously at constant levels in the cell and perform a vital role in the regulation of gene expression.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

A graduate student wants to isolate cells from a patient and grow them perpetually in culture to study a non-cancer related pathology. Which two of the following genes could you introduce into these cells under control of a constitutive promoter to propogate these cells continuously in culture (select two)? A. Telomerase B. Retinoblastoma C. MDM2 D. p21 CIP E. SV40 Large T Antigen

which of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruises

The key to epigenetic regulation is ________. a. controlling accessibility to transcription factors and RNA polymerase binding b. biochemical modification of binding factors c. physical modification of the DNA

Answer 2

Question

Chapter 14, Problem 1TY

Summary Introduction

Introduction: Mechanism of expression of genes is regulated by various types of gene products. These genes can be switched on or off during the course of gene expression. Some genes express continuously, while some express only at the time of need of their expression.

Expert Solution & Answer

Answer to Problem 1TY

Correct answer: Genes that are expressed at all time constantly are called constitutive genes. Hence, the correct answer is option d.

Explanation of Solution

Reason for correct answer:

Constitutive genes are those genes which express at constant levels at all time. Products of such genes regulate processes associated with biochemical activities of cells.

Option d. is given as “constitutive”.

Constitutive genes are special genes that are expressed at constant levels at every time for effective regulation of gene expression process. Hence, the correct answer is option d.

Reasons for incorrect answer:

Option a. is given as, “inducible”.

Inducible genes are genes whose activity is controlled by the external factors. These genes are not expressed all the times in the cell. Hence, option a. is incorrect.

Option b. is given as, “repressible”.

Repressible genes are genes whose activity is affected at the time of higher concentration of products. High product concentration represses these genes to maintain constant level of products in the cell. These genes are not expressed at all time at constant levels in the cell. Hence, option b. is incorrect.

Option c. is given as, “positive”.

No positive genes are associated with the gene regulation process. Hence, option c. is incorrect.

Option e. is given as, “negative”.

No negative genes are associated with the gene regulation and expression mechanisms. Hence, option e. is incorrect.

Hence, the options a., b. ,c., and e. are incorrect.

Conclusion

Constitutive genes express continuously at constant levels in the cell and perform a vital role in the regulation of gene expression.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Question

Chapter 14, Problem 1TY

Summary Introduction

Introduction: Mechanism of expression of genes is regulated by various types of gene products. These genes can be switched on or off during the course of gene expression. Some genes express continuously, while some express only at the time of need of their expression.

Expert Solution & Answer

Answer to Problem 1TY

Correct answer: Genes that are expressed at all time constantly are called constitutive genes. Hence, the correct answer is option d.

Explanation of Solution

Reason for correct answer:

Constitutive genes are those genes which express at constant levels at all time. Products of such genes regulate processes associated with biochemical activities of cells.

Option d. is given as “constitutive”.

Constitutive genes are special genes that are expressed at constant levels at every time for effective regulation of gene expression process. Hence, the correct answer is option d.

Reasons for incorrect answer:

Option a. is given as, “inducible”.

Inducible genes are genes whose activity is controlled by the external factors. These genes are not expressed all the times in the cell. Hence, option a. is incorrect.

Option b. is given as, “repressible”.

Repressible genes are genes whose activity is affected at the time of higher concentration of products. High product concentration represses these genes to maintain constant level of products in the cell. These genes are not expressed at all time at constant levels in the cell. Hence, option b. is incorrect.

Option c. is given as, “positive”.

No positive genes are associated with the gene regulation process. Hence, option c. is incorrect.

Option e. is given as, “negative”.

No negative genes are associated with the gene regulation and expression mechanisms. Hence, option e. is incorrect.

Hence, the options a., b. ,c., and e. are incorrect.

Conclusion

Constitutive genes express continuously at constant levels in the cell and perform a vital role in the regulation of gene expression.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Question

Chapter 14, Problem 1TY

Summary Introduction

Introduction: Mechanism of expression of genes is regulated by various types of gene products. These genes can be switched on or off during the course of gene expression. Some genes express continuously, while some express only at the time of need of their expression.

Expert Solution & Answer

Answer to Problem 1TY

Correct answer: Genes that are expressed at all time constantly are called constitutive genes. Hence, the correct answer is option d.

Explanation of Solution

Reason for correct answer:

Constitutive genes are those genes which express at constant levels at all time. Products of such genes regulate processes associated with biochemical activities of cells.

Option d. is given as “constitutive”.

Constitutive genes are special genes that are expressed at constant levels at every time for effective regulation of gene expression process. Hence, the correct answer is option d.

Reasons for incorrect answer:

Option a. is given as, “inducible”.

Inducible genes are genes whose activity is controlled by the external factors. These genes are not expressed all the times in the cell. Hence, option a. is incorrect.

Option b. is given as, “repressible”.

Repressible genes are genes whose activity is affected at the time of higher concentration of products. High product concentration represses these genes to maintain constant level of products in the cell. These genes are not expressed at all time at constant levels in the cell. Hence, option b. is incorrect.

Option c. is given as, “positive”.

No positive genes are associated with the gene regulation process. Hence, option c. is incorrect.

Option e. is given as, “negative”.

No negative genes are associated with the gene regulation and expression mechanisms. Hence, option e. is incorrect.

Hence, the options a., b. ,c., and e. are incorrect.

Conclusion

Constitutive genes express continuously at constant levels in the cell and perform a vital role in the regulation of gene expression.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Chapter 14, Problem 1TY

Summary Introduction

Introduction: Mechanism of expression of genes is regulated by various types of gene products. These genes can be switched on or off during the course of gene expression. Some genes express continuously, while some express only at the time of need of their expression.

Expert Solution & Answer

Answer to Problem 1TY

Correct answer: Genes that are expressed at all time constantly are called constitutive genes. Hence, the correct answer is option d.

Explanation of Solution

Reason for correct answer:

Constitutive genes are those genes which express at constant levels at all time. Products of such genes regulate processes associated with biochemical activities of cells.

Option d. is given as “constitutive”.

Constitutive genes are special genes that are expressed at constant levels at every time for effective regulation of gene expression process. Hence, the correct answer is option d.

Reasons for incorrect answer:

Option a. is given as, “inducible”.

Inducible genes are genes whose activity is controlled by the external factors. These genes are not expressed all the times in the cell. Hence, option a. is incorrect.

Option b. is given as, “repressible”.

Repressible genes are genes whose activity is affected at the time of higher concentration of products. High product concentration represses these genes to maintain constant level of products in the cell. These genes are not expressed at all time at constant levels in the cell. Hence, option b. is incorrect.

Option c. is given as, “positive”.

No positive genes are associated with the gene regulation process. Hence, option c. is incorrect.

Option e. is given as, “negative”.

No negative genes are associated with the gene regulation and expression mechanisms. Hence, option e. is incorrect.

Hence, the options a., b. ,c., and e. are incorrect.

Conclusion

Constitutive genes express continuously at constant levels in the cell and perform a vital role in the regulation of gene expression.

Answer 6

Chapter 14, Problem 1TY

Summary Introduction

Introduction: Mechanism of expression of genes is regulated by various types of gene products. These genes can be switched on or off during the course of gene expression. Some genes express continuously, while some express only at the time of need of their expression.

Expert Solution & Answer

Answer to Problem 1TY

Correct answer: Genes that are expressed at all time constantly are called constitutive genes. Hence, the correct answer is option d.

Explanation of Solution

Reason for correct answer:

Constitutive genes are those genes which express at constant levels at all time. Products of such genes regulate processes associated with biochemical activities of cells.

Option d. is given as “constitutive”.

Constitutive genes are special genes that are expressed at constant levels at every time for effective regulation of gene expression process. Hence, the correct answer is option d.

Reasons for incorrect answer:

Option a. is given as, “inducible”.

Inducible genes are genes whose activity is controlled by the external factors. These genes are not expressed all the times in the cell. Hence, option a. is incorrect.

Option b. is given as, “repressible”.

Repressible genes are genes whose activity is affected at the time of higher concentration of products. High product concentration represses these genes to maintain constant level of products in the cell. These genes are not expressed at all time at constant levels in the cell. Hence, option b. is incorrect.

Option c. is given as, “positive”.

No positive genes are associated with the gene regulation process. Hence, option c. is incorrect.

Option e. is given as, “negative”.

No negative genes are associated with the gene regulation and expression mechanisms. Hence, option e. is incorrect.

Hence, the options a., b. ,c., and e. are incorrect.

Conclusion

Constitutive genes express continuously at constant levels in the cell and perform a vital role in the regulation of gene expression.

Answer 7

Chapter 14, Problem 1TY

Summary Introduction

Introduction: Mechanism of expression of genes is regulated by various types of gene products. These genes can be switched on or off during the course of gene expression. Some genes express continuously, while some express only at the time of need of their expression.

Answer 8

Expert Solution & Answer

Answer to Problem 1TY

Correct answer: Genes that are expressed at all time constantly are called constitutive genes. Hence, the correct answer is option d.

Answer 9

Expert Solution & Answer

Answer 10

Expert Solution & Answer

Answer 11

Explanation of Solution

Reason for correct answer:

Constitutive genes are those genes which express at constant levels at all time. Products of such genes regulate processes associated with biochemical activities of cells.

Option d. is given as “constitutive”.

Constitutive genes are special genes that are expressed at constant levels at every time for effective regulation of gene expression process. Hence, the correct answer is option d.

Reasons for incorrect answer:

Option a. is given as, “inducible”.

Inducible genes are genes whose activity is controlled by the external factors. These genes are not expressed all the times in the cell. Hence, option a. is incorrect.

Option b. is given as, “repressible”.

Repressible genes are genes whose activity is affected at the time of higher concentration of products. High product concentration represses these genes to maintain constant level of products in the cell. These genes are not expressed at all time at constant levels in the cell. Hence, option b. is incorrect.

Option c. is given as, “positive”.

No positive genes are associated with the gene regulation process. Hence, option c. is incorrect.

Option e. is given as, “negative”.

No negative genes are associated with the gene regulation and expression mechanisms. Hence, option e. is incorrect.

Hence, the options a., b. ,c., and e. are incorrect.

Answer 12

Conclusion

Constitutive genes express continuously at constant levels in the cell and perform a vital role in the regulation of gene expression.

Answer 13

Ch. 14.1 - Prob. 1CC Ch. 14.2 - Which genes are under the control of the lac...Ch. 14.2 - With regard to regulatory proteins and small...Ch. 14.2 - What were the key observations made by Jacob,...Ch. 14.2 - CoreSKILL What was the eventual hypothesis...Ch. 14.2 - Prob. 3EQ Ch. 14.2 - Core Skill: Connections Look back at Fig 9.12....Ch. 14.2 - What are the advantages of having both an...Ch. 14.2 - Prob. 2CS Ch. 14.3 - Prob. 1CC

Mechanism of expression of genes is regulated by various types of gene products. These genes can be switched on or off during the course of gene expression. Some genes express continuously, while some express only at the time of need of their expression.

Videos

Introduction: Mechanism of expression of genes is regulated by various types of gene products. These genes can be switched on or off during the course of gene expression. Some genes express continuously, while some express only at the time of need of their expression.

Answer to Problem 1TY

Explanation of Solution

Want to see more full solutions like this?

Chapter 14 Solutions