
Why are fermentation tubes evaluated at 24 and 48 hours?
What would happen if an organism used up all the carbohydrate in a fermentation tube?
What would the organism use for energy?
What color would the indicator be then?

To analyze:
Fermentation tubes are evaluated at 24 and 48 hours. If an organism used up all carbohydrate in fermentation tube, then what happens and the organism use for energy and the color the indicator shows.
Introduction:
Fermentation is a process that breakdown large and complex sugar into smaller molecules with the help of bacteria and yeast. This process is used to make beer, alcohol, and fermented drinks.
Explanation of Solution
The process occurs in a lack of oxygen known as the anaerobic process as well as produces a significant amount of ATP. Its product is carbon dioxide, lactic acid, and ethanol. The process is very useful in wine as well as beverage industries.
Beer is the product of fermentation that is consumed as an alcoholic beverage. The flavoring of beers is done with hops that usually add bitterness as well as a natural preservative. Fermentation results in natural carbonation within the beer. It contains around four percent to six percent alcohol.
Fermentation can take place without or with the presence of oxygen as well the incubation periods that are prolonged results in the growth of bacteria oxidatively on peptone immediately after consuming the carbohydrate supplied.
A neutralization reaction will take place when an organism will use all the present carbohydrates. The organism will start using peptone as an energy source. The color of the indicator will turn red.
Thus, Fermentation can take place without or with the presence of oxygen as well as the incubation periods that are prolonged results in the growth of bacteria oxidatively on peptone immediately after consuming the carbohydrate supplied.
Want to see more full solutions like this?
Chapter 14 Solutions
Laboratory Experiments in Microbiology (12th Edition) (What's New in Microbiology)
Additional Science Textbook Solutions
Campbell Essential Biology (7th Edition)
The Cosmic Perspective (8th Edition)
Laboratory Manual For Human Anatomy & Physiology
Cosmic Perspective Fundamentals
Microbiology Fundamentals: A Clinical Approach
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:Cengage
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning

