The inference from the given experiment. Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C 14 -cysteinyl-tRNA Cys . They further removed the sulfur group from the cysteine and created alanyl-tRNA Cys . When alanyl-tRNA Cys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.

Question

Want to see more full solutions like this?

Answer 1

Question

Chapter 14, Problem 1NST

Summary Introduction

To determine: The inference from the given experiment.

Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C¹⁴-cysteinyl-tRNA^Cys. They further removed the sulfur group from the cysteine and created alanyl-tRNA^Cys. When alanyl-tRNA^Cys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.

Expert Solution & Answer

Explanation of Solution

As per the given information, a polypeptide chain was synthesized containing alanine. This occurred after adding radioactively labeled alanyl-tRNA^Cys to a synthetic mRNA. From the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Conclusion

Thus, from the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?

You isolate an E. coli strain in which a mutation in the gene encoding the tRNAAla synthetase enzyme causes it to charge both tRNAAla and tRNACyS TRNAS with Alanine (Ala). You sequence the N-terminus of a protein, which normally has the sequence: Met-Cys-Ala-Thr-Tyr-- Which sequence(s) do you expect to obtain? Select one: O Met-Cys-Ala-Thr-Tyr---- O Met-Cys-Cys-Thr-Tyr---- O Met-Ala-Ala-Thr-Tyr---- O Met-Cys-Ala-Thr-Tyr---- + Met-Cys-Cys-Thr-Tyr---- O Met-Cys-Ala-Thr-Tyr---- + Met-Ala-Ala-Thr-Tyr----

Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra aminoacids, and others contained fewer amino acids than normal. a. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning. b. If the same experiment had been conducted on bacterial cells, what results would you expect? c. Explain why some of the proteins produced contained extra amino acids while others contained fewer amino acids than normal.

Answer 2

Question

Chapter 14, Problem 1NST

Summary Introduction

To determine: The inference from the given experiment.

Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C¹⁴-cysteinyl-tRNA^Cys. They further removed the sulfur group from the cysteine and created alanyl-tRNA^Cys. When alanyl-tRNA^Cys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.

Expert Solution & Answer

Explanation of Solution

As per the given information, a polypeptide chain was synthesized containing alanine. This occurred after adding radioactively labeled alanyl-tRNA^Cys to a synthetic mRNA. From the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Conclusion

Thus, from the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Question

Chapter 14, Problem 1NST

Summary Introduction

To determine: The inference from the given experiment.

Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C¹⁴-cysteinyl-tRNA^Cys. They further removed the sulfur group from the cysteine and created alanyl-tRNA^Cys. When alanyl-tRNA^Cys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.

Expert Solution & Answer

Explanation of Solution

As per the given information, a polypeptide chain was synthesized containing alanine. This occurred after adding radioactively labeled alanyl-tRNA^Cys to a synthetic mRNA. From the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Conclusion

Thus, from the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Question

Chapter 14, Problem 1NST

Summary Introduction

To determine: The inference from the given experiment.

Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C¹⁴-cysteinyl-tRNA^Cys. They further removed the sulfur group from the cysteine and created alanyl-tRNA^Cys. When alanyl-tRNA^Cys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.

Expert Solution & Answer

Explanation of Solution

As per the given information, a polypeptide chain was synthesized containing alanine. This occurred after adding radioactively labeled alanyl-tRNA^Cys to a synthetic mRNA. From the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Conclusion

Thus, from the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Chapter 14, Problem 1NST

Summary Introduction

To determine: The inference from the given experiment.

Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C¹⁴-cysteinyl-tRNA^Cys. They further removed the sulfur group from the cysteine and created alanyl-tRNA^Cys. When alanyl-tRNA^Cys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.

Expert Solution & Answer

Explanation of Solution

As per the given information, a polypeptide chain was synthesized containing alanine. This occurred after adding radioactively labeled alanyl-tRNA^Cys to a synthetic mRNA. From the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Conclusion

Thus, from the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Answer 6

Chapter 14, Problem 1NST

Summary Introduction

To determine: The inference from the given experiment.

Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C¹⁴-cysteinyl-tRNA^Cys. They further removed the sulfur group from the cysteine and created alanyl-tRNA^Cys. When alanyl-tRNA^Cys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.

Expert Solution & Answer

Explanation of Solution

As per the given information, a polypeptide chain was synthesized containing alanine. This occurred after adding radioactively labeled alanyl-tRNA^Cys to a synthetic mRNA. From the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Conclusion

Thus, from the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.

Answer 7

Chapter 14, Problem 1NST

Summary Introduction

To determine: The inference from the given experiment.

Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C¹⁴-cysteinyl-tRNA^Cys. They further removed the sulfur group from the cysteine and created alanyl-tRNA^Cys. When alanyl-tRNA^Cys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.

Answer 8

Expert Solution & Answer

Explanation of Solution

As per the given information, a polypeptide chain was synthesized containing alanine. This occurred after adding radioactively labeled alanyl-tRNA^Cys to a synthetic mRNA. From the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.