
Campbell Biology, Books a la Carte Edition & Modified Mastering Biology with Pearson eText -- ValuePack Access Card -- for Campbell Biology
1st Edition
ISBN: 9780133936667
Author: Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13.4, Problem 3CC
Summary Introduction
To explain: The possibility of
Concept introduction:
Crossing over is the process of exchange of gene segments among non-sister homologous chromatids. It forms recombinant chromosomes that contain genetic materials from both parents that generate genetic variation.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 13 Solutions
Campbell Biology, Books a la Carte Edition & Modified Mastering Biology with Pearson eText -- ValuePack Access Card -- for Campbell Biology
Ch. 13.1 - MAKE CONNECTIONS Using what you know of gene...Ch. 13.1 - How does an asexually reproducing eukaryotic...Ch. 13.1 - WHATIF? A horticulturalist breeds orchids, trying...Ch. 13.2 - MAKE CONNECTIONS In Figure 13.4. how many DNA...Ch. 13.2 - VISUAL SKILLS In The karyotype shown in Figuro...Ch. 13.2 - WHAT IF? A certain eukaryote lives as a...Ch. 13.3 - MAKE CONNECTIONS Comparc tho chromosomes in a...Ch. 13.3 - WHAT IF? After the synaptonemal complex...Ch. 13.4 - What is the original source of Variation among the...Ch. 13.4 - The diploid number for fruit flies is 8, and the...
Ch. 13.4 - Prob. 3CCCh. 13 - Explain why human offifuing resemble their parents...Ch. 13 - Compare the life cycles of animals and plants,...Ch. 13 - Prob. 13.3CRCh. 13 - Prob. 13.4CRCh. 13 - A human cell containing 22 autosomes.and a Y...Ch. 13 - The two homologs of a pair move toward opposite...Ch. 13 - Meiosis II is similar to mitosis in that (A)...Ch. 13 - Prob. 4TYUCh. 13 - If we continue to follow the cell lineage from...Ch. 13 - DRAW IT The diagram shows a cell in meiosis. (a)...Ch. 13 - Explain how you can tell that the cell in question...Ch. 13 - EVOLUTION CONNECTION Many species can reproduce...Ch. 13 - SCIENTIFIC INQUIRY The diagram in quest ion 6...Ch. 13 - Prob. 10TYUCh. 13 - SYNTHESIZE YOUR KNOWLEDGE For selected answers,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Genetic Variation and Mutation | 9-1 GCSE Science Biology | OCR, AQA, Edexcel; Author: SnapRevise;https://www.youtube.com/watch?v=bLP8udGGfHU;License: Standard YouTube License, CC-BY