
Foundations in Microbiology
9th Edition
ISBN: 9780073522609
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 13.4, Problem 20ELO
Summary Introduction
Introduction:
Carrier is an individual who inconspicuously harbors an infection and unknowingly spreads it to others.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 13 Solutions
Foundations in Microbiology
Ch. 13.1 - Describe some of the major interactions between...Ch. 13.1 - Prob. 2ELOCh. 13.1 - Discuss the characteristics of the normal...Ch. 13.1 - Briefly relate the sources and conditions that...Ch. 13.1 - Identify which bodily sites remain free of living...Ch. 13.1 - Prob. 6ELOCh. 13.1 - Prob. 1CYPCh. 13.1 - Prob. 2CYPCh. 13.1 - Prob. 3CYPCh. 13.1 - Prob. 4CYP
Ch. 13.1 - Prob. 5CYPCh. 13.1 - Differentiate between transient and resident...Ch. 13.1 - Explain the factors that cause variations in the...Ch. 13.2 - Review the main stages in the development of an...Ch. 13.2 - Prob. 8ELOCh. 13.2 - Prob. 9ELOCh. 13.2 - Prob. 10ELOCh. 13.2 - Prob. 11ELOCh. 13.2 - Identify and discuss invasive factors and...Ch. 13.2 - Prob. 13ELOCh. 13.2 - Explain several ways in which true pathogens...Ch. 13.2 - Distinguish between pathogenicity and virulence.Ch. 13.2 - Prob. 10CYPCh. 13.2 - Prob. 11CYPCh. 13.2 - Prob. 12CYPCh. 13.2 - Describe several components of pathogens that are...Ch. 13.2 - Prob. 14CYPCh. 13.2 - Prob. 15CYPCh. 13.2 - Define toxigenicity and summarize the main...Ch. 13.2 - Prob. 17CYPCh. 13.3 - Describe the clinical stages of infection.Ch. 13.3 - Use key terms to describe different patterns of...Ch. 13.3 - Prob. 16ELOCh. 13.3 - Prob. 17ELOCh. 13.3 - Explain what is happening during each stage of...Ch. 13.3 - Prob. 19CYPCh. 13.3 - Name some examples of infections and their portals...Ch. 13.3 - 21. Using terminology from this section's “Guide...Ch. 13.4 - Define epidemiology, and summarize the major goals...Ch. 13.4 - Prob. 19ELOCh. 13.4 - Prob. 20ELOCh. 13.4 - Prob. 21ELOCh. 13.4 - Prob. 22ELOCh. 13.4 - Prob. 23ELOCh. 13.4 - Prob. 22CYPCh. 13.4 - Prob. 23CYPCh. 13.4 - Prob. 24CYPCh. 13.4 - Prob. 25CYPCh. 13.4 - Prob. 26CYPCh. 13.4 - What is epidemiologically and medically important...Ch. 13.5 - Prob. 24ELOCh. 13.5 - Prob. 25ELOCh. 13.5 - Summarize the steps in Koch’s postulates, and...Ch. 13.5 - Prob. 27ELOCh. 13.5 - Prob. 28ELOCh. 13.5 - Prob. 28CYPCh. 13.5 - Prob. 29CYPCh. 13.5 - Prob. 30CYPCh. 13.5 - Prob. 31CYPCh. 13.5 - Prob. 32CYPCh. 13.5 - Prob. 33CYPCh. 13.L1 - Prob. 1MCQCh. 13.L1 - Prob. 2MCQCh. 13.L1 - Prob. 3MCQCh. 13.L1 - Prob. 4MCQCh. 13.L1 - Prob. 5MCQCh. 13.L1 - Prob. 6MCQCh. 13.L1 - Prob. 7MCQCh. 13.L1 - The presence of a few bacteria in the blood is...Ch. 13.L1 - Prob. 9MCQCh. 13.L1 - A/an ______ is a passive animal transporter of...Ch. 13.L1 - Prob. 11MCQCh. 13.L1 - Prob. 12MCQCh. 13.L1 - Prob. 13MCQCh. 13.L1 - A positive antibody test for HIV would be a...Ch. 13.L1 - Prob. 15MCQCh. 13.L1 - Prob. 16MCQCh. 13.L1 - Prob. 1CSRCh. 13.L1 - Prob. 2CSRCh. 13.L1 - Prob. 3CSRCh. 13.L1 - Prob. 1WCCh. 13.L1 - Prob. 2WCCh. 13.L1 - Prob. 3WCCh. 13.L1 - Prob. 4WCCh. 13.L1 - Prob. 5WCCh. 13.L1 - Prob. 6WCCh. 13.L1 - Prob. 7WCCh. 13.L1 - a. Outline the five types of clinical isolation....Ch. 13.L2 - Discuss the relationship between the vaginal...Ch. 13.L2 - Prob. 2CTCh. 13.L2 - How could the microbiome cause some infections to...Ch. 13.L2 - Each of the nine patient specimens listed below...Ch. 13.L2 - Prob. 5CTCh. 13.L2 - Prob. 6CTCh. 13.L2 - Prob. 7CTCh. 13.L2 - a. Suggest several reasons why respiratory,...Ch. 13.L2 - Summarize the epidemiological findings in the...Ch. 13.L2 - Looking at figure 13.20b. Which pattern of...Ch. 13.L2 - Prob. 1VCCh. 13.L2 - Observe the following maps (a)-(c) of three...
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Health Safety And Nutrition F/Young ChildHealth & NutritionISBN:9781305144767Author:MAROTZPublisher:Cengage
- Issues and Ethics in the Helping Professions (Min...NursingISBN:9781337406291Author:Gerald Corey, Marianne Schneider Corey, Cindy CoreyPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Health Safety And Nutrition F/Young Child
Health & Nutrition
ISBN:9781305144767
Author:MAROTZ
Publisher:Cengage

Issues and Ethics in the Helping Professions (Min...
Nursing
ISBN:9781337406291
Author:Gerald Corey, Marianne Schneider Corey, Cindy Corey
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning