Campbell Biology in Focus
3rd Edition
ISBN: 9780134710679
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Rebecca Orr
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 13.4, Problem 1CC
Summary Introduction
To identify:
The sequence and the types of the bonds that are being cleaved in the sequence of the DNA by the restriction enzyme PvuI namely:
Concept introduction:
The enzyme PvuI cuts in between the T-C
The types of the bonds that will be cleaved in between the nucleotides are the phosphate bonds between the pentose sugar and the nucleotide connecting the next nucleotide in the sequence.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
3
The restriction endonuclease Pstl cuts DNA symmetrically on both strands at the
СТGCAG
sequence:
GACGTC
On the resulting DNA fragments are left 3' overhanging ends of 4 nucleotides. PstI cleaves
the phosphodiester backbone with a-type specificity. In short-hand notation, showing the
identity of phosphates on the ends, draw the two fragments that result from PstI digestion of
the following double-stranded oligonucleotide:
5'-рAATTGCTAСTGCAGAACCGG-3'
3'-ТТAАCGATGACGTCTTGGСС--5'
Sensors detect the flash of
light.
DNA polymerase
Unused
deoxyribonucleotides are
cleaved by apyrase.
ATP is consumed by
luciferase and light is
emitted.
AMP and PP, are
converted into ATP by
sulfurylase.
Template strand
Growing strand
3' TAGGCCTACACTTACGCGAATGT 5'
5' ATCCGGAT 3'
dGTP
dNTPs
dNDPs
dNMPs
+ P₁
PP₁
ATP
[1]
5
Chapter 13 Solutions
Campbell Biology in Focus
Ch. 13.1 - Given a polynucleotide sequence such as GAATTC,...Ch. 13.1 - Prob. 2CCCh. 13.2 - What role does base pairing play in the...Ch. 13.2 - Make a table listing the functions of seven...Ch. 13.2 - MAKE CONNECTIONS What is the relationship between...Ch. 13.3 - Describe the structure of a nucleosome, the basic...Ch. 13.3 - What two properties, one structural and one...Ch. 13.4 - Prob. 1CCCh. 13.4 - DRAW IT One strand of a DNA molecule has the...Ch. 13.4 - Describe the role of complementary base pairing...
Ch. 13 - In his work with pneumonia-causing bacteria and...Ch. 13 - Prob. 2TYUCh. 13 - In analyzing the number of different bases in a...Ch. 13 - The elongation of the leading strand during DNA...Ch. 13 - Prob. 5TYUCh. 13 - Prob. 6TYUCh. 13 - Prob. 7TYUCh. 13 - Prob. 8TYUCh. 13 - Prob. 9TYUCh. 13 - MAKE CONNECTIONS Although the proteins that cause...Ch. 13 - Prob. 11TYUCh. 13 - FOCUS ON EVOLUTION Some bacteria may be able to...Ch. 13 - FOCUS ON ORGANIZATION The continuity of life is...Ch. 13 - Prob. 14TYU
Knowledge Booster
Similar questions
- Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X Garrow_forwardExplain translation more depth please im really confusedarrow_forwardASAParrow_forward
- Please do not copy from anywherearrow_forwardvvnicn the following statements are correct about the repair of a DNA duplex containing the sequence below that is grown INE coli (select all that apply)? Strand A Strand B GATCTAGCCGGCATCCGAT CTAGATCGGACGTAGGCTA Methyl ✔A. MutH cleaves Strand A O B. DNA repair will result in the bold A in strand B being replaced with a C O C. DNA repair will result in the bold G in strand A being replaced with a T ✔ D. Defect will not be properly repaired in dam(-) E coli O E. The mammalian repair system would also correct the mismatch shown based on the methylation status of the DNAarrow_forwardpcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:arrow_forward
- Telomerase supplies its own template RNA molecule as shown in Figure 3 below: B AAUCCCAAU TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the ends (5' and 3') on the DNA and RNA strand at position X, Y and Z, in the Figure 3. (ii) Draw and explain the two loop structures at the end of telomere.arrow_forward. The table opposite shows the standard (coding strand) DNA winlet codes for the 20 amino acids involved in protein synthesi A section of DNA template strand is shown below. 5'-CATCCAAATTGTTGCCCG-3' (a) Write down the sequence of amino acids formed when ti section of DNA is transcribed and translated.arrow_forwardslation The following is the base sequence of an exon portion of a template strand of a DNA molecule: 5' GCC-ATT-CGA-ACT 3 a. What is the base sequence of the hnRNA strand synthesized from the DNA template strand? 3' b. What is the base sequence of the MRNA strand synthesized from the hnRNA strand? c. What codons are present in the mRNA strand produced from the DNA template strand? d. What tRNA molecule anticodons are needed to interact with the codons present in the MRNA strand produced from the template DNA strand? Submt Anwer Try Another Versilon em empts remainingarrow_forward
- Remember when looking up a codon make sure it is in its mRNA form. Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 2.What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this? Often this type of mutation does show symptoms until middle age. What problem does this create? 3.What are three differences between a point mutation and deletion mutationarrow_forwardGive the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'arrow_forwardGeneticsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax