ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260406092
Author: HARTWELL, Leland, HOOD, Leroy, Goldberg, Michael
Publisher: Mcgraw-hill Education/stony Brook University
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 7P
The two graphs that follow represent genomic sequencing data for two fruit flies with scarlet-colored eyes. Each fly is a heterozygote for a chromosome 3 with normal gene order and a recessive scarlet (st) mutation, and a rearranged chromosome 3; the rearrangements are different in the two flies. Each circle on the graph indicates the number of sequence reads (y coordinate) obtained for a 100 bp sequence starting at the position on chromosome 3 that is shown by the x coordinate.
| a. | What is the nature of the rearranged chromosome in each fly? What are the approximate locations of the breakpoints defining these rearrangements? How could you find the exact |
| b. | Can you conclude that at least part of the st gene lies in a particular region of chromosome 3? If so, give the coordinates of that region defined as precisely as possible. |
| c. | Is it possible that one or more protein-coding exons of the st gene lie outside of the region you defined in part (b)? Explain. |
| d. | Does your ability to map the st gene on the basis of these data reflect a recombination experiment or a complementation experiment? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The axial ratio is a term used to describe a rod-shaped molecule using the ratio of its length to its diameter. Given that the
standard conformation of DNA in a physiological solution has a diameter of 2.37 nm, what is the axial ratio of the longest
chromosome of Drosophila melanogaster DNA, which is 21000 µm long? Please record your answer in scientific notation.
axial ratio:
x10
In the Holliday model for homologous recombination shown, the resolution steps can produce recombinant or nonrecombinantchromosomes. Explain how this can occur.
Suppose, you want to detect the CAG repeat expansion within a particular gene (30 repeats in normal changes to 250 repeats in disease) in a certain disease. How will you diagnose this disease condition?
Can you identify Y chromosome microdeletion (which involves the deletion of AZF locus) using conventional karyotyping? If not, then why?
How will you diagnose a chromosomal translocation event? (Discuss any one of the processes)
Chapter 13 Solutions
ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
Ch. 13 - For each of the terms in the left column, choose...Ch. 13 - Prob. 2PCh. 13 - For each of the following types of chromosomal...Ch. 13 - For the following types of chromosomal...Ch. 13 - One of the X chromosomes in a particular...Ch. 13 - A diploid strain of yeast was made by mating a...Ch. 13 - The two graphs that follow represent genomic...Ch. 13 - A series of chromosomal mutations in Drosophila...Ch. 13 - Indicate which of the four major classes of...Ch. 13 - The recessive, X-linked z1 mutation of the...
Ch. 13 - Genes a and b are 21 m.u. apart when mapped in...Ch. 13 - In the following group of figures, the pink lines...Ch. 13 - Three strains of Drosophila Bravo, X-ray, and...Ch. 13 - Two yeast strains were mated and sporulated...Ch. 13 - Suppose a haploid yeast strain carrying two...Ch. 13 - In the mating between two haploid yeast strains...Ch. 13 - During ascus formation in Neurospora, any...Ch. 13 - In the following figure, black and pink lines...Ch. 13 - In Drosophila, the gene for cinnabar eye color is...Ch. 13 - Semisterility in corn, as seen by unfilled ears...Ch. 13 - A promising biological method for insect control...Ch. 13 - Prob. 23PCh. 13 - a. Among the progeny of a self-fertilized...Ch. 13 - Duchenne muscular dystrophy DMD is caused by a...Ch. 13 - WHIM syndrome is a disease of the immune system...Ch. 13 - Explain how transposable elements can cause the...Ch. 13 - The Drosophila genome normally harbors about 40 P...Ch. 13 - Drosophila P elements were discovered because of a...Ch. 13 - Flies homozygous for mutant alleles of a...Ch. 13 - Fred and Mary have a child named Bob. The genomic...Ch. 13 - Uniparental disomy is a rare phenomenon in which...Ch. 13 - Among adults with Turner syndrome, it has been...Ch. 13 - In Neurospora, his2 mutants require the amino acid...Ch. 13 - Human geneticists interested in the effects of...Ch. 13 - The incidence of Down syndrome will be very high...Ch. 13 - The Drosophila chromosome 4 is extremely small;...Ch. 13 - Down syndrome is usually caused by having a...Ch. 13 - Common red clover, Trifolium pratense, is a...Ch. 13 - The numbers of chromosomes in the somatic cells of...Ch. 13 - Prob. 41PCh. 13 - Somatic cells in organisms of a particular diploid...Ch. 13 - An allotetraploid species has a genome composed of...Ch. 13 - Prob. 44PCh. 13 - Chromosomes normally associate during meiosis I as...Ch. 13 - Using whole-genome sequencing, how could you...Ch. 13 - Prob. 47PCh. 13 - Prob. 48PCh. 13 - Seedless watermelons that you find in the...Ch. 13 - The names of hybrid animals are usually themselves...Ch. 13 - While most animals cannot tolerate polyploidy,...Ch. 13 - What characteristic property of translocations...Ch. 13 - Prob. 53PCh. 13 - In the accompanying figure, the top and bottom...Ch. 13 - Prob. 55PCh. 13 - The accompanying figure shows idiograms of human...Ch. 13 - Prob. 57P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Below is shown an annotation indicating the protein coding genes of a Drosophila genomic region. Below this map is shown the structure of an inversion (the vertical lines indicate the breakpoints), three deletions (indicated by the gaps) and three Insertions (indicated by the triangles) 100 S עולם Sara N Deletion Insortion Insertion 2 13829 Inversion 1 Execst PART Deletion? Deletion 3 Insertion 3 You have a mutation in a gene required for the development of the wings. Drosophila homozygous for this mutation have no wings. You cross these Drosophila homozygous for the wingless mutant allele with Drosophila homozygous for the seven mapped DNA changes. Mapped change Phenotype Inversion 1 wingless Deletion 1 wingless Deletion 2 wild type Deletion 3 wild type Insertion 1 wild type Insertion 2 wingless Insertion 3 wild type You conclude that the mutated allele is in which of the below genes? hh unk Irk1 CG46310 cnc Ⓒfzo CG4467 Rad60 EloA wda Pex11c orbarrow_forwardHuman adult hemoglobin is a tetramer containing two alpha (a) and two beta (b) polypeptide chains. The a gene cluster on chromosome 16 and the b gene cluster on chromosome 11 share amino acid similarities such that 61 of the amino acids of the a@globin polypeptide (141 amino acids long) are shared in identical sequence with the b@globin polypeptide (146 amino acids long). How might one explain the existence of two polypeptides with partially shared function and structure on two different chromosomes?arrow_forwardUsing figure 1 and the following background information answer the following questions. Identification of the genetic cause of hornlessness in cattle has been the subject of intensive genetic and genomic research, culminating in the nomination of two different candidate neomutations on cattle chromosome 1 that are predicted to have arisen 500-1,000 years ago: a complex allele of Friesian origin (PF), an 80,128 base pair (bp) duplication (1909352–1989480 bp), and a second, simple allele of Celtic origin (PC) corresponding to a duplication of 212 bp (chromosome 1 positions 1705834–1706045) in place of a 10-bp deletion (1706051–1706060)We report the use of genome editing using transcription activator-like effector nucleases (TALENs) to introgress the putative PC POLLED allele into the genome of bovine embryo fibroblasts to try and produce a genotype identical to what is achievable using natural mating, but without the attendant genetic drag and admixture. In our previous studies, we…arrow_forward
- The fruit fly Drosophila melanogaster has about 2 x 10^8 base pairs of DNA per haploid genome, of which about 75% in nonrepeated DNA. The DNA is distributed among four pairs of homologous chromosomes, which have a total of about 5,000 visible bands when in polytene forms in the salivary gland. The number of genes initially estimated from mutational studies was also about 5,000 but recent DNA sequencing studies suggest that the gene number may be somewhat higher. a. Why was it tempting to speculate that each band corresponds to a single gene? What does this suggest about the number of different proteins Drosophila can make? Does that seem like a reasonable number to you? b. Assuming all the nonrepeated DNA is uniformly distributed in the chromosomes, how much nonrepeated DNA (in base pairs) is there in average band?arrow_forwardFriedreich ataxia (FRDA) is an autosomal recessive, neurodegenerative disease that causes a lack of voluntary coordination of muscle movements. Affected individuals are homozygous for an unusually large number (expansion) of repeats of a trinucleotide sequence (GAA) in the first intron of the X25 gene. Unaffected individuals typically have between 7 and 38 repeats of the trinucleotide (GAAGAAGAAGAA…). FRDA patients have anywhere from 66 to over 1,700 repeats. To understand how the GAA trinucleotide expansion leads to FRDA, researchers looked at X25 gene expression by extracting RNA from affected and unaffected patients and doing a northern blot analysis (see the figure below): In panel “a,” the researchers used a probe to detect X25 mRNA. In panel “b,” the researchers used a probe on a duplicate of the original blot to detect human GAPDH mRNA (GAPDH is an enzyme involved in glycolysis). The sample labeled “YR” is mRNA from yeast cells that was used as a control. Explain…arrow_forwardThe haploid human genome consists of approximately 3.2 × 109 bp (or 6.4 × 109 bp per diploid genome). Assuming that DNA is B-DNA, calculate the total length of a single cell’s DNA.arrow_forward
- An STR on chromosome 5 is very closely linked to a gene involved in a dominant metabolism disorder (one one copy of the mutation causes the disease). There are four different alleles of the STR (Q, B, S, and L), each with different numbers of GATCTCG repeats. The S allele has 2 repeats, the B allele has 7 repeats, the Q allele has 10 repeats, and the L allele has 5 repeats. Part 1 Lane 1 of the gel shown below indicates the locations of PCR products corresponding to all four STR alleles when run together in one lane. DNA was loaded into the wells at the top of the gel. Move the letter of each allele to its correct position at the left of Lane 1 to indicate where each allele runs on the gel. 0000 Gabriel Andre Lane 1 O Maria Andre Maria Juliana B L Part 2 Andre and Maria are the parents in this family; all others shown on the gel are children. Daughter Juliana is born with the metabolism disorder, but daughter Camila does not have the disorder. Assuming no recombination between the STR…arrow_forwardA diploid (ie, contains TWO sets of chromosomes) organisms with a 45,000-kb haploid (counts only one set of its chromosomes) genome contains 21% G residues. Calculate the number of A, C, G< and T residues in the DNA of each cell in this organism. Can you help explain why this is the answer, thank you! Answer: Since the haploid genome contains 21% G, it must contain 21% C (Because G=C) and 58% A + T, or 29% A and 29% T. Each cell is a diploid, containing 90,000 kb or 9x10^7 bases. Therefore, A=T = (0.29)(9x10^7) = 2.61 x 10^7 bases and G=C=(0.21)(9x10^7) = 1.89x10^7 bases.arrow_forwardBased from Fig. 1B, which of the following lanes contain a good quality genomic DNA? Bad quality genomic DNA? Why or Why not? Answer in maximum of 5 sentences only. You can prove your answer by describing the banding pattern of each lanes and how to troubleshoot the DNA extraction procedure if possible.arrow_forward
- A pair of paralogous repeats, A and B, have 96% sequence similarity and therefore can promote non-allelic homologous recombination (NAHR). They exist in four possible arrangements in a genome, illustrated below as arrangements 1 – 4. What is the result of NAHR between repeats A and B in arrangement 1? A.Translocation between chromosomes 1 and 2 resulting in monocentric chromosomes B.Deletion or duplication of the region between A and B C.Translocation between chromosomes 1 and 2 resulting in acentric and dicentric chromosomes D.Inversion of the region between A and Barrow_forwardA 210-bp sequence within the CFTR gene on human chromosome 7 is shown below. The three bold underlined nucleotides are deleted in a common cystic fibrosis (CF) mutation, removing a phenylalanine amino acid from the CFTR protein. 1 AGAGGGTAAA ATTAAGCACA GTGGAAGAAT TTCATTCTGT TCTCAGTTTT 51 CCTGGATTAT GCCTGGCACC ATTAAAGAAA ATATCATCTT TGGTGTTTCC 101 TATGATGAAT ATAGATACAG AAGCGTCATC AAAGCATGCC AACTAGAAGA 151 GGTAAGAAAC TATGTGAAAA CTTTTTGATT ATGCATATGA ACCCTTCACA 201 CTACCCAAAT PCR primers have been designed to amplify fragments within this sequence: Forward: GGATTATGCCTGGCACCATT Reverse: AGTGTGAAGGGTTCATATGC DNA from a CF patient is tested with a PCR assay using a pair of these primers, and the PCR product is found to be 3 bp shorter than that expected from the sequence shown above. What length PCR products (in bp) would you expect in the mother of the CF patient? A. 95 and 92 B. 149 C. 133 and 130 D. 149 and 146 E. 146arrow_forwardColchicine is a chemical mutagen that inhibits the spindle formation and prevents anaphase, which retains the cell’s single restitution nucleus (doubled chromosome number). Suppose that an onion (2n=16) is subjected to three consecutive rounds of colchicine treatment, what will be the resulting chromosome number of the treated onion?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License