
Concept explainers
(a)
To determine: The evidence that supports the doublet code notion.
Introduction: The mRNA consists of many bases. A collection of three bases that has the capability to code for a particular amino acid is called codon. Codons are present in the mRNA. These codons attach with the anticodon part of tRNA to synthesize amino acid. The anticodon part of tRNA is complementary to the codon part of mRNA.
(b)
To determine: The ways by which “early” amino acids are important in terms of the evolution of genetic code.
Introduction: Transcription is the process by which DNA converts into pre-mRNA. The pre-mRNA undergoes post-transcriptional changes and converts into a mature mRNA. The next step after post-transcriptional changes is translation. It is the process by which the mRNA converts into amino acids. The collection of three bases present on the mRNA that codes for a specific protein is called codon. The amino acids join together by polypeptide bond to form protein molecules.
(c)
To determine: Whether the fact that “cysteine, tyrosine, and phenylalanine have only two codons” is a coincidence.
Introduction: A codon can code only for a single amino acid, but an amino acid can be coded by more than one codon. For example, GCU codes for alanine only, but alanine can be coded by GCU, GCC, GCA, and GCG codons.

Want to see the full answer?
Check out a sample textbook solution
Chapter 13 Solutions
Concepts of Genetics (12th Edition)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning





