
Concept explainers
Mark the following statements as true or false. If a statement is false, correct it to make a true statement.
a. The somatic sensory division of the PNS detects sensory stimuli from the organs in the thoracic and abdominopelvic cavities.
b. The somatic motor division of the PNS consists of lower motor neurons that directly innervate skeletal muscle fibers.
c. The visceral motor division is also known as the autonomic nervous system and maintains homeostasis of many physiological variables.
d. The term nerve is the equivalent of the term neuron.
e. There are 31 pairs of spinal nerves and 12 pairs of cranial nerves.

To review:
Whether the following statements are true or false:
1. The somatic sensory division of the PNS detects sensory stimuli from the organs in the thoracic and abdominopelvic cavities.
2. The somatic motor division of the PNS consists of lower motor neurons that directly innervate the skeletal muscle fibers.
3. The visceral motor division is also known as the autonomic nervous system and maintains homeostasis of many physiological variables.
4. The term ‘nerve’ is the equivalent of the term ‘neuron’.
5. There are 31 pairs of spinal nerves and 12 pairs of cranial nerves.
Introduction:
The peripheral nervous system acts as a link which bridges the CNS (central nervous system) with the body and outer environment. In order to link them, it first detects the sensory parts of the stimuli and carries them to the CNS as a sensory input. The CNS works on the input and then distributes the impulses by means of the PNS (peripheral nervous system) to the effectors to generate a motor output. In this case, the effectors are the muscle cells and glands.
Explanation of Solution
a. The statement “The somatic sensory division of the PNS detects sensory stimuli from the organs in the thoracic and abdominopelvic cavities”is false. The correct statement is the somatic sensory division of the PNS detects sensory stimuli from the structures of musculoskeletal system. In fact, they detect the stimuli from the skin and structures of the musculoskeletal system.
b. The statement “The somatic motor division of the PNS consists of lower motor neurons that directly innervate skeletal muscle fibers” is true. In the true sense, the somatic motor division of the PNS consists ofa lower type of motor neurons which are in direct contact with the skeletal muscle fibers.
c. The statement “The visceral motor division is also known as the autonomic nervous systemwhichmaintains homeostasis of many physiological variables” is true. The visceral motor division is also known as the autonomic nervous system which maintains the homeostasis state of many variables which are physiological in nature by controlling the involuntary motor functions of the body.
d. The statement “The term nerve is the equivalent of the term neuron” is true. It is foundthat a nerve contains numerous neurons which are connected to each other by a tissue.
e. The statement “There are 31 pairs of spinal nerves and 12 pairs of cranial nerves” is true. It widely known that there are 31pairs of spinal nerves and 12 pairs of spinal nerves in the human body.
Thus, it can be concluded that the statements(b), (c),(d) and(e) are true according to the reasons provided and the statement (a) is false.
Want to see more full solutions like this?
Chapter 13 Solutions
Human Anatomy & Physiology
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning


