ANATOMY & PHYSIOLOGY (LL) W/ CONNECT
9th Edition
ISBN: 9781265884185
Author: SALADIN
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 12.6, Problem 2AYLO
Summary Introduction
To discuss:
The meanings of excitatory and inhibitory postsynaptic potentials (EPSPs and IPSPs).
Introduction:
The neural integration depends on the postsynaptic potentials that are generated by neurotransmitters. The threshold of typical neuron is -55 mV and the resting membrane potential (RMP) is -70 mV. In order to produce an action potential, a neuron must be depolarized to this threshold.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 12 Solutions
ANATOMY & PHYSIOLOGY (LL) W/ CONNECT
Ch. 12.1 - What is a receptor? Give two examples of...Ch. 12.1 - Distinguish between the central and peripheral...Ch. 12.1 - Prob. 3BYGOCh. 12.1 - What the nervous and endocrine systems have in...Ch. 12.1 - Three fundamental functions of the nervous system;...Ch. 12.1 - Differences between the central nervous system...Ch. 12.1 - The autonomic nervous system and its two divisionsCh. 12.2 - Sketch a multipolar neuron and label its...Ch. 12.2 - Explain the differences between a sensory neuron,...Ch. 12.2 - Prob. 6BYGO
Ch. 12.2 - Prob. 7BYGOCh. 12.2 - Three fundamental physiological properties of...Ch. 12.2 - Prob. 2AYLOCh. 12.2 - Prob. 3AYLOCh. 12.2 - Prob. 4AYLOCh. 12.2 - Ways in winch neurons transport substances between...Ch. 12.3 - Prob. 8BYGOCh. 12.3 - Prob. 9BYGOCh. 12.3 - Prob. 10BYGOCh. 12.3 - Six kinds of neuroglia; the structure and...Ch. 12.3 - Prob. 2AYLOCh. 12.3 - Prob. 3AYLOCh. 12.3 - The regeneration of a damaged nerve fiber; the...Ch. 12.4 - Prob. 11BYGOCh. 12.4 - Prob. 12BYGOCh. 12.4 - Prob. 13BYGOCh. 12.4 - Prob. 14BYGOCh. 12.4 - Prob. 15BYGOCh. 12.4 - Prob. 16BYGOCh. 12.4 - Prob. 17BYGOCh. 12.4 - Prob. 1AYLOCh. 12.4 - What an electrical current is, and how sodium ions...Ch. 12.4 - How stimulation of a neuron generates a local...Ch. 12.4 - Prob. 4AYLOCh. 12.4 - Prob. 5AYLOCh. 12.4 - Prob. 6AYLOCh. 12.4 - Prob. 7AYLOCh. 12.4 - How one action potential triggers another; how the...Ch. 12.4 - Saltatory conduction in a myelinated nerve fiber,...Ch. 12.5 - Prob. 18BYGOCh. 12.5 - Prob. 19BYGOCh. 12.5 - Prob. 20BYGOCh. 12.5 - Prob. 21BYGOCh. 12.5 - Prob. 1AYLOCh. 12.5 - Prob. 2AYLOCh. 12.5 - Prob. 3AYLOCh. 12.5 - Prob. 4AYLOCh. 12.5 - Excitatory synapses; how acetylcholine and...Ch. 12.5 - Prob. 6AYLOCh. 12.5 - Prob. 7AYLOCh. 12.5 - Prob. 8AYLOCh. 12.5 - Prob. 9AYLOCh. 12.6 - Prob. 22BYGOCh. 12.6 - Prob. 23BYGOCh. 12.6 - Prob. 24BYGOCh. 12.6 - Contrast serial and parallel processing and...Ch. 12.6 - Prob. 26BYGOCh. 12.6 - Explain how long-term potentiation and long-term...Ch. 12.6 - Prob. 1AYLOCh. 12.6 - Prob. 2AYLOCh. 12.6 - Prob. 3AYLOCh. 12.6 - How a postsynaptic neurons decision to fire...Ch. 12.6 - Prob. 5AYLOCh. 12.6 - Mechanisms of presynaptic facilitation and...Ch. 12.6 - Prob. 7AYLOCh. 12.6 - Prob. 8AYLOCh. 12.6 - The meanings of neural pool and neural circuitCh. 12.6 - The difference between a neurons discharge zone...Ch. 12.6 - Diverging, converging, reverberating, and parallel...Ch. 12.6 - The difference between serial and parallel...Ch. 12.6 - The cellular basis of memory; what memory consists...Ch. 12.6 - Prob. 14AYLOCh. 12.6 - Prob. 15AYLOCh. 12 - The integrative functions of the nervous system...Ch. 12 - The highest density of voltage-gated ion channels...Ch. 12 - The soma of a mature neuron lacks a. a nucleus. b....Ch. 12 - The glial cells that fight infections in the CNS...Ch. 12 - Posttetanic potentiation of a synapse increases...Ch. 12 - An IPSP is_____of the postsynaptic neuron. a. a...Ch. 12 - Prob. 7TYRCh. 12 - Prob. 8TYRCh. 12 - Prob. 9TYRCh. 12 - Prob. 10TYRCh. 12 - Prob. 11TYRCh. 12 - Prob. 12TYRCh. 12 - Prob. 13TYRCh. 12 - Prob. 14TYRCh. 12 - Prob. 15TYRCh. 12 - A myelinated nerve fiber can produce action...Ch. 12 - Prob. 17TYRCh. 12 - Prob. 18TYRCh. 12 - Prob. 19TYRCh. 12 - Prob. 20TYRCh. 12 - Prob. 1BYMVCh. 12 - Prob. 2BYMVCh. 12 - Prob. 3BYMVCh. 12 - Prob. 4BYMVCh. 12 - Prob. 5BYMVCh. 12 - Prob. 6BYMVCh. 12 - Prob. 7BYMVCh. 12 - Prob. 8BYMVCh. 12 - Prob. 9BYMVCh. 12 - Prob. 10BYMVCh. 12 - Prob. 1WWTSCh. 12 - Prob. 2WWTSCh. 12 - Prob. 3WWTSCh. 12 - Prob. 4WWTSCh. 12 - Excitatory postsynaptic potentials lower the...Ch. 12 - Prob. 6WWTSCh. 12 - Prob. 7WWTSCh. 12 - Myelinated nerve fibers conduct signals more...Ch. 12 - Prob. 9WWTSCh. 12 - Prob. 10WWTSCh. 12 - Schizophrenia is sometimes treated with drugs such...Ch. 12 - Hyperkalemia is an excess of potassium ill the...Ch. 12 - Suppose a poison were to slow down the Na+-K+...Ch. 12 - Prob. 4TYCCh. 12 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning