
EBK HUMAN ANATOMY
9th Edition
ISBN: 9780135241752
Author: Marieb
Publisher: PEARSON CO
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 12, Problem 24RQ
Summary Introduction
To review:
The term axon and dendrite.
Introduction:
Nerve cell is the structural unit of the nervous system. The nervous system is categorized into the central nervous system and the peripheral nervous system. The central nervous system contains the brain and the spinal cord. The spinal cord arises from the brainstem and runs up to the lumbar region of the vertebral column. The spinal cord provides spinal nerves that run toward the body parts and regulates the communication process between the central nervous system and the body parts.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 12 Solutions
EBK HUMAN ANATOMY
Ch. 12 - In which direction are afferent signals carried?...Ch. 12 - What subdivision of the nervous system regulates...Ch. 12 - What type of sensation is (a) pain from a pulled...Ch. 12 - Which type of neuron process receives stimuli?Ch. 12 - Describe how the electrical impulse from one...Ch. 12 - What is the structural type of most sensory...Ch. 12 - Which structural type of neuron is most abundant?...Ch. 12 - Which neuroglia make myelin in the CNS? In the...Ch. 12 - Which neuroglia are common in regions where...Ch. 12 - Do Schwann cells cover nonmyelinated axons in the...
Ch. 12 - Name the connective tissue wrapping that encloses...Ch. 12 - Where do synaspes occur in the CNS, in white...Ch. 12 - Why is white matter white?Ch. 12 - If there is no interneuron in a reflex arc, as in...Ch. 12 - If you touch a hot stove, you reflexively...Ch. 12 - What type of neuronal circuit contains multiple...Ch. 12 - Both peripheral nerves and the white matter of the...Ch. 12 - From your understanding of the functions of myelin...Ch. 12 - What type of neurons form from neuroblasts in the...Ch. 12 - How does the development of sensory neurons...Ch. 12 - Prob. 1RQCh. 12 - Match the names of the cells in column B with the...Ch. 12 - Prob. 3RQCh. 12 - Prob. 4RQCh. 12 - An example of an effector is (a) the eye, (b) a...Ch. 12 - Prob. 6RQCh. 12 - A ganglion is a collection of (a) neuron cell...Ch. 12 - A synapse between a terminal bouton and a neuron...Ch. 12 - Myelin is most like which of the following cell...Ch. 12 - Prob. 10RQCh. 12 - Afferent neurons of the PNS synapse in the CNS...Ch. 12 - Prob. 12RQCh. 12 - Prob. 13RQCh. 12 - Place the connective tissue coverings surrounding...Ch. 12 - Define proprioception.Ch. 12 - Prob. 16RQCh. 12 - Prob. 17RQCh. 12 - Distinguish gray matter from white matter of the...Ch. 12 - What is distinctive about the appearance of a cell...Ch. 12 - Describe the differences between neurons and...Ch. 12 - Distinguish a nerve from a nerve fiber and a...Ch. 12 - Prob. 22RQCh. 12 - Draw a reflex arc in place in the nervous system...Ch. 12 - Prob. 24RQCh. 12 - Why are the cell bodies of sensory neurons located...Ch. 12 - Prob. 26RQCh. 12 - Two anatomists were arguing about a sensory...Ch. 12 - An MRI scan and other diagnostic tests indicated...Ch. 12 - Prob. 3CRCAQCh. 12 - Rochelle developed multiple sclerosis when she was...Ch. 12 - Reflexes can be somatic (as in the knee-jerk...Ch. 12 - Prob. 6CRCAQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College