MICROBIOLOGY W/ACCESS
4th Edition
ISBN: 9781266808685
Author: Cowan
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Question
Chapter 12, Problem 1MCQ
Summary Introduction
Introduction:
Antibiotics are sometimes naturally formed chemicals which are released by soil
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 12 Solutions
MICROBIOLOGY W/ACCESS
Ch. 12.1 - State the main goal of antimicrobial treatment.Ch. 12.1 - Identify sources of the most commonly used...Ch. 12.1 - Summarize two methods for testing antimicrobial...Ch. 12.1 - Prob. 4AYPCh. 12.2 - Prob. 5AYPCh. 12.2 - Describe the five major targets of antimicrobial...Ch. 12.2 - Identify which categories of drugs are most...Ch. 12.3 - Prob. 2CFCh. 12.3 - Prob. 8AYPCh. 12.3 - Trace the development of penicillin...
Ch. 12.3 - Prob. 10AYPCh. 12.3 - Prob. 11AYPCh. 12.3 - Prob. 12AYPCh. 12.3 - Prob. 13AYPCh. 12.3 - Identify the cellular target of quinolones, and...Ch. 12.3 - Prob. 15AYPCh. 12.3 - Prob. 16AYPCh. 12.3 - Prob. 17AYPCh. 12.3 - Prob. 18AYPCh. 12.3 - Describe two major modes of action of antiviral...Ch. 12.4 - Prob. 20AYPCh. 12.4 - Prob. 21AYPCh. 12.4 - Discuss at least three novel antimicrobial...Ch. 12.5 - Distinguish between drug toxicity and allergic...Ch. 12.5 - Prob. 24AYPCh. 12 - Prob. 1CFCh. 12 - Prob. 1MCQCh. 12 - Prob. 2MCQCh. 12 - Prob. 3MCQCh. 12 - Microbial resistance to drugs is acquired through...Ch. 12 - Prob. 5MCQCh. 12 - Prob. 6MCQCh. 12 - Prob. 7MCQCh. 12 - Which of the following modes of action would be...Ch. 12 - Prob. 9MCQCh. 12 - Prob. 10MCQCh. 12 - Prob. 11TFCh. 12 - Prob. 12TFCh. 12 - Biofilms are difficult to treat and do not always...Ch. 12 - Prob. 14TFCh. 12 - Prob. 15TFCh. 12 - Construct a paragraph describing the...Ch. 12 - Prob. 2CTQCh. 12 - Prob. 3CTQCh. 12 - Prob. 4CTQCh. 12 - Prob. 5CTQCh. 12 - Prob. 6CTQCh. 12 - Antibiotic-resistance genes, as well as other...Ch. 12 - Prob. 8CTQCh. 12 - Prob. 9CTQCh. 12 - Prob. 10CTQCh. 12 - Prob. 1CCCh. 12 - Prob. 2CCCh. 12 - Figure 12.5. Where could penicillinase affect each...Ch. 12 - From chapter 6, process figure 6.14a. Describe as...Ch. 12 - Prob. 1CM
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage
- Basic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:CengageMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning