
Concept explainers
Differentiate between these terms: chromosome, chromatin, and chromatid.

To differentiate: Between chromosomes, chromatin, and chromatid.
Introduction: Chromatin is a complex macromolecule, which contains DNA, protein as well as RNA. Chromosome is a densely packaged chromatin. It is a thread like structure present in nucleus of the cell. A chromosome has a constriction point in the middle called centromere. Chromosomes duplicate during the process of cell division and form sister chromatids, which further gets separted into two chromosomes.
Explanation of Solution
Chromosome, chromatin, and chromatid all occur in the nucleus of the cells, but have some basic differences. The difference between chromosomes, chromatin, and chromatid is shown below:
Criteria | Chromosomes | Chromatin | Chromatid |
Definition | Chromosomes is condensed form of chromatin, which contains DNA and proteins. | Chromatin is very fine interdispersed form of DNA associated with protein and RNA. | The identical pieces of DNA that is held together by acentromere and pulled apart in the cell division process to make new identical cells that are called sister chromatids. |
Want to see more full solutions like this?
Chapter 12 Solutions
Campbell Biology (11th Edition)
Additional Science Textbook Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Laboratory Experiments in Microbiology (12th Edition) (What's New in Microbiology)
Cosmic Perspective Fundamentals
Organic Chemistry (8th Edition)
Chemistry: An Introduction to General, Organic, and Biological Chemistry (13th Edition)
Physics for Scientists and Engineers: A Strategic Approach, Vol. 1 (Chs 1-21) (4th Edition)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning





