HUMAN ANATOMY
6th Edition
ISBN: 9781260986037
Author: SALADIN
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 12, Problem 12.1.7AYLO
Summary Introduction
To determine:
About the flexor carpi radialis, flexor carpi ulnaris, flexor digitorum superficialis, and palmaris longus.
Introduction:
Both extrinsic and intrinsic muscles are present in the hand. The intrinsic muscles are in the hand and the extrinsic muscles are located in the forearm. The extrinsic muscles are located in a round shape in the upper forearm. The tendons of these muscles extend to the wrist and the hand. The functions of these muscles are to flex and extend the wrist and digits, and moreover, make the digits to undergo abduction, adduction, radial and ulnar flexion.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 12 Solutions
HUMAN ANATOMY
Ch. 12.1 - Prob. 1AWYKCh. 12.1 - Prob. 2AWYKCh. 12.1 - Prob. 1BYGOCh. 12.1 - Prob. 2BYGOCh. 12.1 - Prob. 3BYGOCh. 12.1 - Prob. 4BYGOCh. 12.1 - Prob. 5BYGOCh. 12.1 - Prob. 6BYGOCh. 12.2 - Not everyone has the same muscles. From the...Ch. 12.2 - Prob. 7BYGO
Ch. 12.2 - Name the muscles that cross both the hip and knee...Ch. 12.2 - Prob. 9BYGOCh. 12.2 - Prob. 10BYGOCh. 12.3 - Prob. 11BYGOCh. 12.3 - Prob. 12BYGOCh. 12 - Prob. 12.1.1AYLOCh. 12 - Prob. 12.1.2AYLOCh. 12 - Prob. 12.1.3AYLOCh. 12 - Prob. 12.1.4AYLOCh. 12 - Prob. 12.1.5AYLOCh. 12 - Prob. 12.1.6AYLOCh. 12 - Prob. 12.1.7AYLOCh. 12 - Prob. 12.1.8AYLOCh. 12 - Prob. 12.1.9AYLOCh. 12 - Prob. 12.1.10AYLOCh. 12 - Prob. 12.1.11AYLOCh. 12 - Prob. 12.1.12AYLOCh. 12 - Prob. 12.1.13AYLOCh. 12 - Prob. 12.1.14AYLOCh. 12 - Prob. 12.1.15AYLOCh. 12 - Prob. 12.2.1AYLOCh. 12 - The three gluteal muscles-gluteus maximus, gluteus...Ch. 12 - The tensor fasciae latae of the hip and its...Ch. 12 - Prob. 12.2.4AYLOCh. 12 - Prob. 12.2.5AYLOCh. 12 - Prob. 12.2.6AYLOCh. 12 - Prob. 12.2.7AYLOCh. 12 - The hamstring muscles of the posterior compartment...Ch. 12 - Prob. 12.2.9AYLOCh. 12 - Prob. 12.2.10AYLOCh. 12 - Prob. 12.2.11AYLOCh. 12 - Prob. 12.2.12AYLOCh. 12 - Prob. 12.2.13AYLOCh. 12 - Prob. 12.2.14AYLOCh. 12 - Prob. 12.2.15AYLOCh. 12 - Prob. 12.3.1AYLOCh. 12 - Prob. 12.3.2AYLOCh. 12 - Prob. 1TYRCh. 12 - Prob. 2TYRCh. 12 - Prob. 3TYRCh. 12 - Prob. 4TYRCh. 12 - Which of these muscles does not contribute to the...Ch. 12 - Which of these actions is not performed by the...Ch. 12 - Prob. 7TYRCh. 12 - Prob. 8TYRCh. 12 - Both the gastrocnemius and ____________ muscles...Ch. 12 - Prob. 10TYRCh. 12 - Prob. 11TYRCh. 12 - Prob. 12TYRCh. 12 - Pronation of the forearm is achieved by two...Ch. 12 - Prob. 14TYRCh. 12 - Prob. 15TYRCh. 12 - Prob. 16TYRCh. 12 - Prob. 17TYRCh. 12 - Prob. 18TYRCh. 12 - Prob. 19TYRCh. 12 - Prob. 20TYRCh. 12 - Prob. 1BYMVCh. 12 - Prob. 2BYMVCh. 12 - State a meaning of each world element and give a...Ch. 12 - Prob. 4BYMVCh. 12 - Prob. 5BYMVCh. 12 - Prob. 6BYMVCh. 12 - State a meaning of each world element and give a...Ch. 12 - Prob. 8BYMVCh. 12 - Prob. 9BYMVCh. 12 - Prob. 10BYMVCh. 12 - Briefly explain why each of the following...Ch. 12 - Prob. 2WWWTSCh. 12 - Prob. 3WWWTSCh. 12 - Prob. 4WWWTSCh. 12 - Prob. 5WWWTSCh. 12 - Briefly explain why each of the following...Ch. 12 - Briefly explain why each of the following...Ch. 12 - Prob. 8WWWTSCh. 12 - Prob. 9WWWTSCh. 12 - Prob. 10WWWTSCh. 12 - Prob. 1TYCCh. 12 - Prob. 2TYCCh. 12 - Poorly conditioned middle-aged people may suffer a...Ch. 12 - Women who habitually wear high heels may suffer...Ch. 12 - A student moving out of a dormitory crouches in...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeFundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage LearningMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Lifetime Physical Fitness & WellnessHealth & NutritionISBN:9781337677509Author:HOEGERPublisher:Cengage

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Fundamentals of Sectional Anatomy: An Imaging App...
Biology
ISBN:9781133960867
Author:Denise L. Lazo
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Lifetime Physical Fitness & Wellness
Health & Nutrition
ISBN:9781337677509
Author:HOEGER
Publisher:Cengage
12 Organ Systems | Roles & functions | Easy science lesson; Author: Learn Easy Science;https://www.youtube.com/watch?v=cQIU0yJ8RBg;License: Standard youtube license