Superficial compartment muscles of the leg. Introduction: The posterior compartment of the leg consists of 7 muscles that are arranged into two layers: deep and the superficial muscles. These layers are divided by a band of the fascia. The posterior part is the largest part of the leg. The muscles of this region are innervated by the tibial nerve and sciatic nerve.

Question

Want to see the full answer?

Answer 1

Question

Chapter 12, Problem 12.2.11AYLO

Summary Introduction

To analyze:

Superficial compartment muscles of the leg.

Introduction:

The posterior compartment of the leg consists of 7 muscles that are arranged into two layers: deep and the superficial muscles. These layers are divided by a band of the fascia. The posterior part is the largest part of the leg. The muscles of this region are innervated by the tibial nerve and sciatic nerve.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

What would happen if transcriptome analysis were done on liver and muscle cells?

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

Answer 2

Question

Chapter 12, Problem 12.2.11AYLO

Summary Introduction

To analyze:

Superficial compartment muscles of the leg.

Introduction:

The posterior compartment of the leg consists of 7 muscles that are arranged into two layers: deep and the superficial muscles. These layers are divided by a band of the fascia. The posterior part is the largest part of the leg. The muscles of this region are innervated by the tibial nerve and sciatic nerve.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 12, Problem 12.2.11AYLO

Summary Introduction

To analyze:

Superficial compartment muscles of the leg.

Introduction:

The posterior compartment of the leg consists of 7 muscles that are arranged into two layers: deep and the superficial muscles. These layers are divided by a band of the fascia. The posterior part is the largest part of the leg. The muscles of this region are innervated by the tibial nerve and sciatic nerve.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 12, Problem 12.2.11AYLO

Summary Introduction

To analyze:

Superficial compartment muscles of the leg.

Introduction:

The posterior compartment of the leg consists of 7 muscles that are arranged into two layers: deep and the superficial muscles. These layers are divided by a band of the fascia. The posterior part is the largest part of the leg. The muscles of this region are innervated by the tibial nerve and sciatic nerve.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 12, Problem 12.2.11AYLO

Summary Introduction

To analyze:

Superficial compartment muscles of the leg.

Introduction:

The posterior compartment of the leg consists of 7 muscles that are arranged into two layers: deep and the superficial muscles. These layers are divided by a band of the fascia. The posterior part is the largest part of the leg. The muscles of this region are innervated by the tibial nerve and sciatic nerve.

Answer 6

Chapter 12, Problem 12.2.11AYLO

Summary Introduction

To analyze:

Superficial compartment muscles of the leg.

Introduction:

The posterior compartment of the leg consists of 7 muscles that are arranged into two layers: deep and the superficial muscles. These layers are divided by a band of the fascia. The posterior part is the largest part of the leg. The muscles of this region are innervated by the tibial nerve and sciatic nerve.

Answer 7

Chapter 12, Problem 12.2.11AYLO

Summary Introduction

To analyze:

Superficial compartment muscles of the leg.

Introduction:

The posterior compartment of the leg consists of 7 muscles that are arranged into two layers: deep and the superficial muscles. These layers are divided by a band of the fascia. The posterior part is the largest part of the leg. The muscles of this region are innervated by the tibial nerve and sciatic nerve.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 12.1 - Prob. 1AWYK Ch. 12.1 - Prob. 2AWYK Ch. 12.1 - Prob. 1BYGO Ch. 12.1 - Prob. 2BYGO Ch. 12.1 - Prob. 3BYGO Ch. 12.1 - Prob. 4BYGO Ch. 12.1 - Prob. 5BYGO Ch. 12.1 - Prob. 6BYGO Ch. 12.2 - Not everyone has the same muscles. From the...Ch. 12.2 - Prob. 7BYGO

Solution Summary: The author explains that the posterior compartment of the leg consists of 7 muscles that are arranged into two layers: deep and superficial.

Concept explainers

Videos

Want to see the full answer?

Chapter 12 Solutions