LSC (CONCORDIA UNIV ST PAUL) BIO 315/316: B&N DPF Connect with APR and Phils Online Access for Anatomy and Physiology: The Unity of Form and Function 180 Day Access ENTRP
9th Edition
ISBN: 9781264794645
Author: Kenneth Saladin
Publisher: McGraw-Hill Learning Solutions
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11.7, Problem 15AYLO
The role of smooth muscle in peristalsis
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 11 Solutions
LSC (CONCORDIA UNIV ST PAUL) BIO 315/316: B&N DPF Connect with APR and Phils Online Access for Anatomy and Physiology: The Unity of Form and Function 180 Day Access ENTRP
Ch. 11.1 - Prob. 1BYGOCh. 11.1 - Prob. 2BYGOCh. 11.1 - Prob. 3BYGOCh. 11.1 - Five physiological properties of all muscular...Ch. 11.1 - Prob. 2AYLOCh. 11.1 - Prob. 3AYLOCh. 11.1 - Prob. 4AYLOCh. 11.2 - Prob. 4BYGOCh. 11.2 - Prob. 5BYGOCh. 11.2 - Prob. 6BYGO
Ch. 11.2 - Prob. 7BYGOCh. 11.2 - Prob. 1AYLOCh. 11.2 - Prob. 2AYLOCh. 11.2 - Prob. 3AYLOCh. 11.2 - Prob. 4AYLOCh. 11.2 - Prob. 5AYLOCh. 11.2 - Prob. 6AYLOCh. 11.2 - Prob. 7AYLOCh. 11.2 - Prob. 8AYLOCh. 11.2 - Prob. 9AYLOCh. 11.2 - Prob. 10AYLOCh. 11.3 - Prob. 8BYGOCh. 11.3 - Prob. 9BYGOCh. 11.3 - Prob. 10BYGOCh. 11.3 - Prob. 11BYGOCh. 11.3 - Prob. 12BYGOCh. 11.3 - Motor units; the meanings of large and small motor...Ch. 11.3 - Prob. 2AYLOCh. 11.3 - Prob. 3AYLOCh. 11.3 - Prob. 4AYLOCh. 11.3 - Prob. 5AYLOCh. 11.3 - How an action potential differs from the RMP, and...Ch. 11.4 - Prob. 13BYGOCh. 11.4 - Prob. 14BYGOCh. 11.4 - Prob. 15BYGOCh. 11.4 - Prob. 16BYGOCh. 11.4 - Prob. 1AYLOCh. 11.4 - Prob. 2AYLOCh. 11.4 - Prob. 3AYLOCh. 11.4 - Muscle relaxation; how the cessation of the nerve...Ch. 11.4 - Prob. 5AYLOCh. 11.4 - Prob. 6AYLOCh. 11.5 - Prob. 17BYGOCh. 11.5 - Prob. 18BYGOCh. 11.5 - Prob. 19BYGOCh. 11.5 - Prob. 20BYGOCh. 11.5 - Prob. 1AYLOCh. 11.5 - The phases of a muscle twitchCh. 11.5 - Prob. 3AYLOCh. 11.5 - How recruitment and tetanus are produced and how...Ch. 11.5 - Prob. 5AYLOCh. 11.6 - Prob. 21BYGOCh. 11.6 - Prob. 22BYGOCh. 11.6 - Prob. 23BYGOCh. 11.6 - Prob. 24BYGOCh. 11.6 - Prob. 25BYGOCh. 11.6 - Prob. 1AYLOCh. 11.6 - Prob. 2AYLOCh. 11.6 - The use of myoglobin and aerobic respiration to...Ch. 11.6 - Prob. 4AYLOCh. 11.6 - How anaerobic fermentation generates ATP after the...Ch. 11.6 - Why a muscle is able to switch back to aerobic...Ch. 11.6 - Prob. 7AYLOCh. 11.6 - Vo2max, it partially determines ones ability to...Ch. 11.6 - Prob. 9AYLOCh. 11.6 - Differences between slow oxidative and fast...Ch. 11.6 - Prob. 11AYLOCh. 11.6 - Examples of resistance exercise and endurance...Ch. 11.7 - Prob. 26BYGOCh. 11.7 - Prob. 27BYGOCh. 11.7 - Prob. 28BYGOCh. 11.7 - Prob. 29BYGOCh. 11.7 - Prob. 30BYGOCh. 11.7 - Prob. 1AYLOCh. 11.7 - Structural differences between cardiomyocytes and...Ch. 11.7 - Prob. 3AYLOCh. 11.7 - Prob. 4AYLOCh. 11.7 - Prob. 5AYLOCh. 11.7 - Prob. 6AYLOCh. 11.7 - Prob. 7AYLOCh. 11.7 - Prob. 8AYLOCh. 11.7 - Prob. 9AYLOCh. 11.7 - Prob. 10AYLOCh. 11.7 - Prob. 11AYLOCh. 11.7 - Prob. 12AYLOCh. 11.7 - Prob. 13AYLOCh. 11.7 - Prob. 14AYLOCh. 11.7 - The role of smooth muscle in peristalsisCh. 11.7 - Prob. 16AYLOCh. 11 - Prob. 1TYRCh. 11 - Prob. 2TYRCh. 11 - Prob. 3TYRCh. 11 - Prob. 4TYRCh. 11 - Prob. 5TYRCh. 11 - Prob. 6TYRCh. 11 - ACh receptors are found mainly in a. synaptic...Ch. 11 - Prob. 8TYRCh. 11 - Prob. 9TYRCh. 11 - Slow oxidative fibers have all of the following...Ch. 11 - Prob. 11TYRCh. 11 - Prob. 12TYRCh. 11 - Parts of the sarcoplasmic reticulum called ______...Ch. 11 - Prob. 14TYRCh. 11 - Prob. 15TYRCh. 11 - Prob. 16TYRCh. 11 - Prob. 17TYRCh. 11 - Prob. 18TYRCh. 11 - A state of continual partial muscle contraction is...Ch. 11 - Prob. 20TYRCh. 11 - Prob. 1BYMVCh. 11 - Prob. 2BYMVCh. 11 - dys-Ch. 11 - iso-Ch. 11 - Prob. 5BYMVCh. 11 - Prob. 6BYMVCh. 11 - Prob. 7BYMVCh. 11 - temporo-Ch. 11 - Prob. 9BYMVCh. 11 - Prob. 10BYMVCh. 11 - Prob. 1WWTSCh. 11 - Prob. 2WWTSCh. 11 - Prob. 3WWTSCh. 11 - Prob. 4WWTSCh. 11 - Thin filaments shorten when a muscle contracts.Ch. 11 - Smooth muscle lacks striations because it does not...Ch. 11 - Prob. 7WWTSCh. 11 - Prob. 8WWTSCh. 11 - Prob. 9WWTSCh. 11 - Prob. 10WWTSCh. 11 - Prob. 1TYCCh. 11 - Prob. 2TYCCh. 11 - Why would skeletal muscle be unsuitable for the...Ch. 11 - As skeletal muscle contracts, one or more bands of...Ch. 11 - Prob. 5TYC
Additional Science Textbook Solutions
Find more solutions based on key concepts
Practice Problem ATTEMPT
Write the rate expressions for each of the following reactions:
(a)
(b)
(c)
Chemistry
How does the removal of hydrogen atoms from nutrient molecules result in a loss of energy from the nutrient mol...
SEELEY'S ANATOMY+PHYSIOLOGY
Label each statement about the polynucleotide ATGGCG as true or false. The polynucleotide has six nucleotides. ...
General, Organic, and Biological Chemistry - 4th edition
Single penny tossed 20 times and counting heads and tails: Probability (prediction): _______/20 heads ________/...
Laboratory Manual For Human Anatomy & Physiology
4. 38 Strontium has four naturally occurring isotopes, with mass numbers 84, 86, 87, arid 88.
a. Write the atom...
General, Organic, and Biological Chemistry: Structures of Life (5th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Understanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:CengageHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
12 Organ Systems | Roles & functions | Easy science lesson; Author: Learn Easy Science;https://www.youtube.com/watch?v=cQIU0yJ8RBg;License: Standard youtube license