BIOLOGY
5th Edition
ISBN: 9781265202859
Author: BROOKER
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 11.4, Problem 2CC
Summary Introduction
To explain: The strand out of leading and lagging strands that are made discontinuously in the direction opposite to the movement of the replication fork.
Introduction: DNA stands for “Deoxyribonucleic acid”. It is a
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How many replication forks are formed at the origin of replication?
Why can’t the lagging strand be synthesized in the same direction of the replication fork?
In terms of the new DNA strands that are generated, what are the differences between replication and conventional polymerase chain reaction?
Chapter 11 Solutions
BIOLOGY
Ch. 11.1 - Prob. 1CSCh. 11.1 - Prob. 1EQCh. 11.1 - Prob. 2EQCh. 11.1 - CoreSKILL In the experiment of Avery, MacLeod,...Ch. 11.2 - Prob. 1CCCh. 11.2 - Prob. 2CCCh. 11.2 - Core Skill: Modeling The goal of this modeling...Ch. 11.2 - Prob. 2CSCh. 11.3 - If this experiment was conducted for four rounds...Ch. 11.4 - Molecular Mechanism of DNA Replication Concept...
Ch. 11.4 - Prob. 2CCCh. 11.4 - Prob. 3CCCh. 11.4 - Prob. 4CCCh. 11.5 - Prob. 1CCCh. 11.5 - Prob. 1CSCh. 11 - Why did researchers initially believe that the...Ch. 11 - Prob. 2TYCh. 11 - Which of the following equations is accurate...Ch. 11 - Prob. 4TYCh. 11 - Which of the following statements about the...Ch. 11 - Meselson and Stahl were able to demonstrate...Ch. 11 - During replication of a DNA molecule, the daughter...Ch. 11 - Prob. 8TYCh. 11 - A nucleosome is a. a dark-staining body composed...Ch. 11 - The conversion of euchromatin into heterochromatin...Ch. 11 - What are the four key criteria that the genetic...Ch. 11 - A double-stranded DNA molecule contains 560...Ch. 11 - Prob. 3CQCh. 11 - Prob. 1COQCh. 11 - CoreSKILL How might you provide evidence that DNA...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is the end-replication problem? Why, in the absence of telomerase, do the ends of linear chromosomes get progressively shorter each time the DNA is replicated?arrow_forwardThe sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forwardDNA polymerases are processive, which means that they remain tightly associated with the template strand while moving rapidly and adding nucleotides to the growing daughter stand. Which piece of the replication machinery accounts for this characteristic? Helicase Sliding Clamp Single Stranded Binding Protein Primasearrow_forward
- What does DNA polymerase need in order to make contact with a replication origin?arrow_forwardDNA polymerase occasionally incorporates the wrong nucleotide during DNA replication. If left unrepaired, the base-pair mismatch that results will lead to mutation in the next replication. As part of a template strand, the incorporated wrong base will direct the incorporation of a base complementary to itself, so the bases on both strands of the DNA at that position will now be different from what they were before the mismatch event. The MM-minus strain of yeast does not have a functional mismatch excision repair system, but it has normal base excision repair and nucleotide excision repair systems. Which of the following statements is correct about differences in the mutation spectrum between MMR-minus and wildtype yeast? More than one answer is correct. (a) More point mutations will arise in MMR-minus yeast. Fewer point mutations will arise in MMR-minus yeast as compared with wildtype. (b) Of the total point mutations that do occur, the fraction in which G is replaced by C will be…arrow_forwardDNA polymerase occasionally incorporates the wrong nucleotide during DNA replication. If left unrepaired, the base-pair mismatch that results will lead to mutation in the next replication. As part of a template strand, the incorporated wrong base will direct the incorporation of a base complementary to itself, so the bases on both strands of the DNA at that position will now be different from what they were before the mismatch event. The MER-minus strain of yeast does not have a functional mismatch excision repair system, but it has normal base excision repair and nucleotide excision repair systems. Which of the following statements is correct about differences in the mutation spectrum between MER-minus and wildtype yeast? More than one answer is correct. Options: More point mutations will arise in MER-minus yeast. Fewer point mutations will arise in MER-minus yeast as compared with wildtype. Of the total point mutations that…arrow_forward
- What is origion of replication?arrow_forwardWhat are the three major requirements of replication?arrow_forwardIn the scenario where a single strand break occurs in the DNA replication fork: a) What would happen if RecC failed to bind to the chi site? Explain briefly and draw out the step at which recombinational DNA repair would stall. b) What would happen if RecA failed to bind DNA? Explain briefly and draw out the step at which recombinational DNA repair would stall. c) Draw the resolved product of this Holliday junction if it's cleaved in the direction of the white triangles. Is the result a heteroplex or recombinant? A Strand Invasion Ⓒ Holliday Junction A Resolvearrow_forward
- If the gene for primase were mutated so that no functional primase was produced, what would be the effect on theta replication? On rolling circle replication?arrow_forwardWhat mechanism was originally proposed as one of the three models for DNA replication? What is the name given to the short stretches of DNA formed on the lagging strand? How can these short fragments be initiated?arrow_forwardWhether the statement "When bidirectional replication forks from adjacent origins meet, a leading strand always runs into a lagging strand" is true or false.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY