How transcription factors may fine-tune the level of gene expression. Introduction: The protein that controls the transcription rate by binding to the DNA sequence at specific sites is known as transcription factors. The function of transcription factors is to regulate the expression of the gene in the right type of the cell in right amount throughout the life of the organism. Transcription factors number depends on the size of the genome, the increase in the size of the genome results in the more transcription factors. They regulate the gene expression by binding to the promoter or enhancer regions of DNA.

Question

Want to see the full answer?

Answer 1

Question

Chapter 11.3, Problem 3CYP

Summary Introduction

To explain:

How transcription factors may fine-tune the level of gene expression.

Introduction:

The protein that controls the transcription rate by binding to the DNA sequence at specific sites is known as transcription factors. The function of transcription factors is to regulate the expression of the gene in the right type of the cell in right amount throughout the life of the organism. Transcription factors number depends on the size of the genome, the increase in the size of the genome results in the more transcription factors. They regulate the gene expression by binding to the promoter or enhancer regions of DNA.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?

Answer 2

Question

Chapter 11.3, Problem 3CYP

Summary Introduction

To explain:

How transcription factors may fine-tune the level of gene expression.

Introduction:

The protein that controls the transcription rate by binding to the DNA sequence at specific sites is known as transcription factors. The function of transcription factors is to regulate the expression of the gene in the right type of the cell in right amount throughout the life of the organism. Transcription factors number depends on the size of the genome, the increase in the size of the genome results in the more transcription factors. They regulate the gene expression by binding to the promoter or enhancer regions of DNA.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 11.3, Problem 3CYP

Summary Introduction

To explain:

How transcription factors may fine-tune the level of gene expression.

Introduction:

The protein that controls the transcription rate by binding to the DNA sequence at specific sites is known as transcription factors. The function of transcription factors is to regulate the expression of the gene in the right type of the cell in right amount throughout the life of the organism. Transcription factors number depends on the size of the genome, the increase in the size of the genome results in the more transcription factors. They regulate the gene expression by binding to the promoter or enhancer regions of DNA.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 11.3, Problem 3CYP

Summary Introduction

To explain:

How transcription factors may fine-tune the level of gene expression.

Introduction:

The protein that controls the transcription rate by binding to the DNA sequence at specific sites is known as transcription factors. The function of transcription factors is to regulate the expression of the gene in the right type of the cell in right amount throughout the life of the organism. Transcription factors number depends on the size of the genome, the increase in the size of the genome results in the more transcription factors. They regulate the gene expression by binding to the promoter or enhancer regions of DNA.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 11.3, Problem 3CYP

Summary Introduction

To explain:

How transcription factors may fine-tune the level of gene expression.

Introduction:

The protein that controls the transcription rate by binding to the DNA sequence at specific sites is known as transcription factors. The function of transcription factors is to regulate the expression of the gene in the right type of the cell in right amount throughout the life of the organism. Transcription factors number depends on the size of the genome, the increase in the size of the genome results in the more transcription factors. They regulate the gene expression by binding to the promoter or enhancer regions of DNA.

Answer 6

Chapter 11.3, Problem 3CYP

Summary Introduction

To explain:

How transcription factors may fine-tune the level of gene expression.

Introduction:

The protein that controls the transcription rate by binding to the DNA sequence at specific sites is known as transcription factors. The function of transcription factors is to regulate the expression of the gene in the right type of the cell in right amount throughout the life of the organism. Transcription factors number depends on the size of the genome, the increase in the size of the genome results in the more transcription factors. They regulate the gene expression by binding to the promoter or enhancer regions of DNA.

Answer 7

Chapter 11.3, Problem 3CYP

Summary Introduction

To explain:

How transcription factors may fine-tune the level of gene expression.

Introduction:

The protein that controls the transcription rate by binding to the DNA sequence at specific sites is known as transcription factors. The function of transcription factors is to regulate the expression of the gene in the right type of the cell in right amount throughout the life of the organism. Transcription factors number depends on the size of the genome, the increase in the size of the genome results in the more transcription factors. They regulate the gene expression by binding to the promoter or enhancer regions of DNA.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 11.1 - Understand how scientists determined that DNA was...Ch. 11.1 - Prob. 2LO Ch. 11.1 - Prob. 3LO Ch. 11.1 - Prob. 4LO Ch. 11.1 - List the three major types of RNA, and describe...Ch. 11.1 - Prob. 1CYP Ch. 11.1 - Prob. 2CYP Ch. 11.1 - Prob. 3CYP Ch. 11.1 - Prob. 4CYP Ch. 11.1 - Prob. 1A

Concept explainers

Videos

Want to see the full answer?

Chapter 11 Solutions