
BIOLOGY:CONCEPTS+INVEST.-CONNECT ACCESS
5th Edition
ISBN: 9781260542233
Author: Hoefnagels
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11.2, Problem 5MC
How does PCR work, and why is it useful?
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 11 Solutions
BIOLOGY:CONCEPTS+INVEST.-CONNECT ACCESS
Ch. 11.1 - Prob. 1MCCh. 11.1 - Prob. 2MCCh. 11.2 - What are some uses for transgenic organisms?Ch. 11.2 - Prob. 2MCCh. 11.2 - Prob. 3MCCh. 11.2 - What is the function of the 98.5% of the human...Ch. 11.2 - How does PCR work, and why is it useful?Ch. 11.2 - Prob. 6MCCh. 11.2 - Why do investigators sometimes analyze...Ch. 11.3 - Prob. 1MC
Ch. 11.3 - Prob. 2MCCh. 11.3 - Summarize the steps scientists use to clone an...Ch. 11.3 - Prob. 4MCCh. 11.4 - Prob. 1MCCh. 11.4 - Prob. 2MCCh. 11.4 - Prob. 3MCCh. 11.4 - Prob. 4MCCh. 11.4 - What are some examples of ethical questions raised...Ch. 11.5 - Prob. 1MCCh. 11.5 - Prob. 2MCCh. 11 - If a restriction enzyme cuts between the G and the...Ch. 11 - Which of the following is not a reason that...Ch. 11 - Prob. 3MCQCh. 11 - Prob. 4MCQCh. 11 - Prob. 5MCQCh. 11 - Prob. 6MCQCh. 11 - Prob. 7MCQCh. 11 - What techniques might researchers use to create...Ch. 11 - Prob. 2WIOCh. 11 - Prob. 3WIOCh. 11 - Prob. 4WIOCh. 11 - Why are entire genomes not used for DNA profiling?Ch. 11 - In a 2013 investigation, researchers discovered...Ch. 11 - Unneeded genes in an adult animal cell are...Ch. 11 - Prob. 8WIOCh. 11 - Prob. 9WIOCh. 11 - Prob. 10WIOCh. 11 - If a cells genome is analogous to a cookbook and a...Ch. 11 - Prob. 12WIOCh. 11 - Review the Survey the Landscape figure in the...Ch. 11 - How does PCR relate to DNA profiling and...Ch. 11 - Add the terms restriction enzyme, plasmid, virus,...
Additional Science Textbook Solutions
Find more solutions based on key concepts
True or false? Some trails are considered vestigial because they existed long ago.
Biological Science (6th Edition)
1. Rub your hands together vigorously. What happens? Discuss the energy transfers and transformations that take...
College Physics: A Strategic Approach (3rd Edition)
What is the pH range for acidic solutions? For basic solutions?
EBK INTRODUCTION TO CHEMISTRY
Determine [OH], [H+], and the pH of each of the following solutions. a. 1.0 M KCl b. 1.0 M KC2H3O2
Chemistry
Single penny tossed 20 times and counting heads and tails: Probability (prediction): _______/20 heads ________/...
Laboratory Manual For Human Anatomy & Physiology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License