Match the term gastrocnemius with the most closely related description given below: abducts the toes flexes hip and/or lumbar spine adduct (retract) scapula connective tissue bands plantar flexion at ankle originates on ilium flexes elbow dorsiflexes ankle and inverts foot lateral rotation of humerus at shoulder supinates forearm extends, adducts, medially rotates humerus at shoulder Introduction: The large gastrocnemius and the soleus ate the foot’s plantar flexor. The soleus acts synergistically to the gastrocnemius and it increases the speed and the force of the plantar flexion.

Question

Want to see the full answer?

Answer 1

Question

Chapter 11, Problem 9RFT

Summary Introduction

To review:

Match the term gastrocnemius with the most closely related description given below:

abducts the toes

flexes hip and/or lumbar spine

adduct (retract) scapula

connective tissue bands

plantar flexion at ankle

originates on ilium

flexes elbow

dorsiflexes ankle and inverts foot

lateral rotation of humerus at shoulder

supinates forearm

extends, adducts, medially rotates humerus at shoulder

Introduction:

The large gastrocnemius and the soleus ate the foot’s plantar flexor. The soleus acts synergistically to the gastrocnemius and it increases the speed and the force of the plantar flexion.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

What would happen if transcriptome analysis were done on liver and muscle cells?

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

Answer 2

Question

Chapter 11, Problem 9RFT

Summary Introduction

To review:

Match the term gastrocnemius with the most closely related description given below:

abducts the toes

flexes hip and/or lumbar spine

adduct (retract) scapula

connective tissue bands

plantar flexion at ankle

originates on ilium

flexes elbow

dorsiflexes ankle and inverts foot

lateral rotation of humerus at shoulder

supinates forearm

extends, adducts, medially rotates humerus at shoulder

Introduction:

The large gastrocnemius and the soleus ate the foot’s plantar flexor. The soleus acts synergistically to the gastrocnemius and it increases the speed and the force of the plantar flexion.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 11, Problem 9RFT

Summary Introduction

To review:

Match the term gastrocnemius with the most closely related description given below:

abducts the toes

flexes hip and/or lumbar spine

adduct (retract) scapula

connective tissue bands

plantar flexion at ankle

originates on ilium

flexes elbow

dorsiflexes ankle and inverts foot

lateral rotation of humerus at shoulder

supinates forearm

extends, adducts, medially rotates humerus at shoulder

Introduction:

The large gastrocnemius and the soleus ate the foot’s plantar flexor. The soleus acts synergistically to the gastrocnemius and it increases the speed and the force of the plantar flexion.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 11, Problem 9RFT

Summary Introduction

To review:

Match the term gastrocnemius with the most closely related description given below:

abducts the toes

flexes hip and/or lumbar spine

adduct (retract) scapula

connective tissue bands

plantar flexion at ankle

originates on ilium

flexes elbow

dorsiflexes ankle and inverts foot

lateral rotation of humerus at shoulder

supinates forearm

extends, adducts, medially rotates humerus at shoulder

Introduction:

The large gastrocnemius and the soleus ate the foot’s plantar flexor. The soleus acts synergistically to the gastrocnemius and it increases the speed and the force of the plantar flexion.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 11, Problem 9RFT

Summary Introduction

To review:

Match the term gastrocnemius with the most closely related description given below:

abducts the toes

flexes hip and/or lumbar spine

adduct (retract) scapula

connective tissue bands

plantar flexion at ankle

originates on ilium

flexes elbow

dorsiflexes ankle and inverts foot

lateral rotation of humerus at shoulder

supinates forearm

extends, adducts, medially rotates humerus at shoulder

Introduction:

The large gastrocnemius and the soleus ate the foot’s plantar flexor. The soleus acts synergistically to the gastrocnemius and it increases the speed and the force of the plantar flexion.

Answer 6

Chapter 11, Problem 9RFT

Summary Introduction

To review:

Match the term gastrocnemius with the most closely related description given below:

abducts the toes

flexes hip and/or lumbar spine

adduct (retract) scapula

connective tissue bands

plantar flexion at ankle

originates on ilium

flexes elbow

dorsiflexes ankle and inverts foot

lateral rotation of humerus at shoulder

supinates forearm

extends, adducts, medially rotates humerus at shoulder

Introduction:

The large gastrocnemius and the soleus ate the foot’s plantar flexor. The soleus acts synergistically to the gastrocnemius and it increases the speed and the force of the plantar flexion.

Answer 7

Chapter 11, Problem 9RFT

Summary Introduction

To review:

Match the term gastrocnemius with the most closely related description given below:

abducts the toes

flexes hip and/or lumbar spine

adduct (retract) scapula

connective tissue bands

plantar flexion at ankle

originates on ilium

flexes elbow

dorsiflexes ankle and inverts foot

lateral rotation of humerus at shoulder

supinates forearm

extends, adducts, medially rotates humerus at shoulder

Introduction:

The large gastrocnemius and the soleus ate the foot’s plantar flexor. The soleus acts synergistically to the gastrocnemius and it increases the speed and the force of the plantar flexion.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 11 - Match each numbered item with the most closely...Ch. 11 - Prob. 2RFT Ch. 11 - Prob. 3RFT Ch. 11 - Prob. 4RFT Ch. 11 - Prob. 5RFT Ch. 11 - Prob. 6RFT Ch. 11 - Match each numbered item with the most closely...Ch. 11 - Prob. 8RFT Ch. 11 - Prob. 9RFT Ch. 11 - Prob. 10RFT

Solution Summary: The author explains that the term gastrocnemius can be correctly matched with the most closely related description given below.

Concept explainers

Want to see the full answer?

Chapter 11 Solutions