
Biology: The Essentials
3rd Edition
ISBN: 9781260140705
Author: Marielle Hoefnagels
Publisher: Mcgraw-hill Higher Education (us)
expand_more
expand_more
format_list_bulleted
Question
Chapter 11, Problem 7WIO
Summary Introduction
To determine:
The advantages and disadvantages of sequencing an entire chromosome from a DNA sample collected at a crime scene.
Introduction:
The genome of most of the living organisms contains double-stranded DNA. Each strand is composed of four nucleotides that are linked from end to end to form a long chain. The human genome is usually packed into separate units, called chromosomes. The process of determining the sequence of
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?
Chapter 11 Solutions
Biology: The Essentials
Ch. 11.1 - What is DNA technology?Ch. 11.1 - In what fields is DNA technology useful?Ch. 11.2 - What are some uses for transgenic organisms?Ch. 11.2 - What are the steps in producing a transgenic...Ch. 11.2 - How do tagged nucleotides participate in first...Ch. 11.2 - What is the function of 98.5 of the human genome...Ch. 11.2 - How does PCR work, and why is it useful?Ch. 11.2 - How are short tandem repeats used in DNA...Ch. 11.2 - Why do investigators sometimes analyze...Ch. 11.3 - Describe the differences among embryonic, adult,...
Ch. 11.3 - What are the potential medical benefits of stem...Ch. 11.3 - Summarize the steps scientists use to clone an...Ch. 11.3 - Why is the technique used to clone mammals called...Ch. 11.4 - Explain how and why a researcher might use a DNA...Ch. 11.4 - Compare and contrast preimplantation genetic...Ch. 11.4 - Prob. 3MCCh. 11.4 - Describe how CRISPR-Cas9 targets a specific gene...Ch. 11.4 - Prob. 5MCCh. 11 - If a restriction enzyme cuts between G and A...Ch. 11 - Which of the following is not a reason that...Ch. 11 - The function of electrophoresis is to a. break a...Ch. 11 - Why is PCR useful? a. Because it replicates all...Ch. 11 - Suppose an investigator at the scene of a murder...Ch. 11 - What is an induced pluripotent stem cell? a. A...Ch. 11 - Dolly the sheep was the first clone of an adult...Ch. 11 - Prob. 8MCQCh. 11 - Preimplantation genetic diagnosis would be least...Ch. 11 - What is the role of a virus in gene therapy? a. It...Ch. 11 - What techniques might researchers use to produce...Ch. 11 - Transgenic crops often require fewer herbicides...Ch. 11 - Describe why sorting DNA fragments by size is...Ch. 11 - Explain how the ingredients in a PCR reaction tube...Ch. 11 - Prob. 5WIOCh. 11 - Why are entire genomes not used for DNA profiling?Ch. 11 - Prob. 7WIOCh. 11 - Mature neurons in the brain do not replicate. Why...Ch. 11 - Unneeded genes in an adult animal cell are...Ch. 11 - Scientists are interested in cloning an extinct...Ch. 11 - Prob. 11WIOCh. 11 - Prob. 12WIOCh. 11 - Use the Internet to research an application of...Ch. 11 - Prob. 14WIOCh. 11 - Review Burning Question 11.11, which describes the...Ch. 11 - Review the Survey the Landscape figure in the...Ch. 11 - How does PCR related to DNA profiling and...Ch. 11 - Add the terms restriction enzyme, plasmid, virus,...Ch. 11 - How is a patient who receives gene therapy similar...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Developmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forwardBiology How would you make 1 L of 0.5X TBE buffer using5X TBE buffer solution and distilled water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningCase Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
DNA Use In Forensic Science; Author: DeBacco University;https://www.youtube.com/watch?v=2YIG3lUP-74;License: Standard YouTube License, CC-BY
Analysing forensic evidence | The Laboratory; Author: Wellcome Collection;https://www.youtube.com/watch?v=68Y-OamcTJ8;License: Standard YouTube License, CC-BY