Biology: The Essentials
Biology: The Essentials
3rd Edition
ISBN: 9781260140705
Author: Marielle Hoefnagels
Publisher: Mcgraw-hill Higher Education (us)
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences?

TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a. Two
b. Three
c. Four
d. Five
Expert Solution & Answer
Check Mark
Summary Introduction

Introduction:

Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.

Answer to Problem 1MCQ

Correct answer:

GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.

Explanation of Solution

Reason for correct answer:

Option c. is given as, “Four.”

Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.

Reason for incorrect answer:

Option a. is given as, “Two.”

GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.

Option b. is given as, “Three.”

When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.

Option d. is given as, “Five.”

GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.

Hence, the options a., b., and d. are incorrect.

Conclusion

GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
I have a question. I need to make 25 mL of this solution . How would I calculate the math? Please help
Introduction to blood lab report
Which of the structural components listed in the Essential terms of section 1.3 (Cell components) could occur in a plant cell? Paragraph く BIUA 川く く 80 + кл K

Chapter 11 Solutions

Biology: The Essentials

Ch. 11.3 - What are the potential medical benefits of stem...Ch. 11.3 - Summarize the steps scientists use to clone an...Ch. 11.3 - Why is the technique used to clone mammals called...Ch. 11.4 - Explain how and why a researcher might use a DNA...Ch. 11.4 - Compare and contrast preimplantation genetic...Ch. 11.4 - Prob. 3MCCh. 11.4 - Describe how CRISPR-Cas9 targets a specific gene...Ch. 11.4 - Prob. 5MCCh. 11 - If a restriction enzyme cuts between G and A...Ch. 11 - Which of the following is not a reason that...Ch. 11 - The function of electrophoresis is to a. break a...Ch. 11 - Why is PCR useful? a. Because it replicates all...Ch. 11 - Suppose an investigator at the scene of a murder...Ch. 11 - What is an induced pluripotent stem cell? a. A...Ch. 11 - Dolly the sheep was the first clone of an adult...Ch. 11 - Prob. 8MCQCh. 11 - Preimplantation genetic diagnosis would be least...Ch. 11 - What is the role of a virus in gene therapy? a. It...Ch. 11 - What techniques might researchers use to produce...Ch. 11 - Transgenic crops often require fewer herbicides...Ch. 11 - Describe why sorting DNA fragments by size is...Ch. 11 - Explain how the ingredients in a PCR reaction tube...Ch. 11 - Prob. 5WIOCh. 11 - Why are entire genomes not used for DNA profiling?Ch. 11 - Prob. 7WIOCh. 11 - Mature neurons in the brain do not replicate. Why...Ch. 11 - Unneeded genes in an adult animal cell are...Ch. 11 - Scientists are interested in cloning an extinct...Ch. 11 - Prob. 11WIOCh. 11 - Prob. 12WIOCh. 11 - Use the Internet to research an application of...Ch. 11 - Prob. 14WIOCh. 11 - Review Burning Question 11.11, which describes the...Ch. 11 - Review the Survey the Landscape figure in the...Ch. 11 - How does PCR related to DNA profiling and...Ch. 11 - Add the terms restriction enzyme, plasmid, virus,...Ch. 11 - How is a patient who receives gene therapy similar...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Text book image
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Biology
ISBN:9781305967359
Author:STARR
Publisher:CENGAGE L
Text book image
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License