HUMAN ANATOMY
6th Edition
ISBN: 9781260986037
Author: SALADIN
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 11, Problem 11.2.2AYLO
Summary Introduction
To determine:
The functions of different muscles, such as prime movers, synergists, antagonists, and fixators.
Introduction:
Muscles perform different functions in the body of an individual. These muscles can act independently and can work in a group to produce a specific effect. There are different types of muscles present in the body that perform various functions.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 11 Solutions
HUMAN ANATOMY
Ch. 11.1 - Name and define each connective tissue of a muscle...Ch. 11.1 - Describe how the fascicles of a muscle are...Ch. 11.1 - Prob. 3BYGOCh. 11.1 - Prob. 4BYGOCh. 11.1 - Prob. 5BYGOCh. 11.1 - Prob. 6BYGOCh. 11.2 - Prob. 1AWYKCh. 11.2 - Prob. 7BYGOCh. 11.2 - Prob. 8BYGOCh. 11.2 - Prob. 9BYGO
Ch. 11.3 - What is meant by the innervation of a muscle? Why...Ch. 11.3 - Prob. 11BYGOCh. 11.4 - Of the muscles you have studied so far, name three...Ch. 11.4 - Name two muscles that elevate the upper lip and...Ch. 11.4 - Name the four paired muscles of mastication and...Ch. 11.4 - Distinguish between the functions of the...Ch. 11.4 - List the prime movers of neck extension and...Ch. 11.5 - What muscles are eaten as “spare ribs”? What is...Ch. 11.5 - Prob. 16BYGOCh. 11.5 - Prob. 17BYGOCh. 11.5 - Name a major superficial muscle and two major deep...Ch. 11.5 - Define perineum, urogenital triangle, and anal...Ch. 11.5 - Name one muscle in the superficial perineal space,...Ch. 11 - Prob. 11.1.1AYLOCh. 11 - Prob. 11.1.2AYLOCh. 11 - Prob. 11.1.3AYLOCh. 11 - Prob. 11.1.4AYLOCh. 11 - Prob. 11.1.5AYLOCh. 11 - Prob. 11.1.6AYLOCh. 11 - Prob. 11.1.7AYLOCh. 11 - Prob. 11.1.8AYLOCh. 11 - Prob. 11.1.9AYLOCh. 11 - Prob. 11.2.1AYLOCh. 11 - Prob. 11.2.2AYLOCh. 11 - The three basic components of a lever and how...Ch. 11 - Why a single musculoskeletal lever cannot produce...Ch. 11 - Prob. 11.2.5AYLOCh. 11 - Prob. 11.3.1AYLOCh. 11 - Prob. 11.3.2AYLOCh. 11 - Prob. 11.4.1AYLOCh. 11 - Prob. 11.4.2AYLOCh. 11 - Prob. 11.4.3AYLOCh. 11 - Prob. 11.4.4AYLOCh. 11 - Prob. 11.4.5AYLOCh. 11 - Three muscles of the cheek, chin, and anterior...Ch. 11 - The difference between the intrinsic and extrinsic...Ch. 11 - Four extrinsic tongue muscles-the genioglossus,...Ch. 11 - Prob. 11.4.9AYLOCh. 11 - Prob. 11.4.10AYLOCh. 11 - Prob. 11.4.11AYLOCh. 11 - Four muscles of the infrahyoid group-the omohyoid,...Ch. 11 - Prob. 11.4.13AYLOCh. 11 - Prob. 11.4.14AYLOCh. 11 - Prob. 11.4.15AYLOCh. 11 - Prob. 11.4.16AYLOCh. 11 - The diaphragm and the three layers of intercostal...Ch. 11 - Prob. 11.5.2AYLOCh. 11 - Prob. 11.5.3AYLOCh. 11 - Prob. 11.5.4AYLOCh. 11 - Prob. 11.5.5AYLOCh. 11 - Prob. 11.5.6AYLOCh. 11 - Prob. 11.5.7AYLOCh. 11 - The boundaries of the perineum; its two triangles;...Ch. 11 - Prob. 11.5.9AYLOCh. 11 - Prob. 11.5.10AYLOCh. 11 - Prob. 11.5.11AYLOCh. 11 - Prob. 11.5.12AYLOCh. 11 - Prob. 1TYRCh. 11 - Prob. 2TYRCh. 11 - Which of these is not a suprahyoid muscle?...Ch. 11 - Prob. 4TYRCh. 11 - Prob. 5TYRCh. 11 - Prob. 6TYRCh. 11 - Prob. 7TYRCh. 11 - Prob. 8TYRCh. 11 - A muscle that aids in chewing without moving the...Ch. 11 - Prob. 10TYRCh. 11 - Prob. 11TYRCh. 11 - Prob. 12TYRCh. 11 - Prob. 13TYRCh. 11 - Prob. 14TYRCh. 11 - Prob. 15TYRCh. 11 - Prob. 16TYRCh. 11 - Prob. 17TYRCh. 11 - Prob. 18TYRCh. 11 - Prob. 19TYRCh. 11 - Prob. 20TYRCh. 11 - Prob. 1BYMVCh. 11 - Prob. 2BYMVCh. 11 - Prob. 3BYMVCh. 11 - Prob. 4BYMVCh. 11 - Prob. 5BYMVCh. 11 - Prob. 6BYMVCh. 11 - Prob. 7BYMVCh. 11 - State a meaning of each word element and give a...Ch. 11 - Prob. 9BYMVCh. 11 - Prob. 10BYMVCh. 11 - Prob. 1WWWTSCh. 11 - Prob. 2WWWTSCh. 11 - Briefly explain why each of the following...Ch. 11 - Prob. 4WWWTSCh. 11 - Prob. 5WWWTSCh. 11 - Prob. 6WWWTSCh. 11 - Prob. 7WWWTSCh. 11 - Prob. 8WWWTSCh. 11 - Prob. 9WWWTSCh. 11 - Prob. 10WWWTSCh. 11 - Name one antagonist of each of the following...Ch. 11 - Name one synergist of each of the following...Ch. 11 - Prob. 3TYCCh. 11 - Remova of cancerous lymph nodes from the neck...Ch. 11 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningLifetime Physical Fitness & WellnessHealth & NutritionISBN:9781337677509Author:HOEGERPublisher:Cengage

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Lifetime Physical Fitness & Wellness
Health & Nutrition
ISBN:9781337677509
Author:HOEGER
Publisher:Cengage
12 Organ Systems | Roles & functions | Easy science lesson; Author: Learn Easy Science;https://www.youtube.com/watch?v=cQIU0yJ8RBg;License: Standard youtube license