
Concept explainers
To determine:The senses that are being tested by probing needle.
Introduction: The largest sense organ in the body is skin. It is present as a covering throughout the body of a living organism. The skin has various types of receptors that are stimulated under different conditions, like pain, itch, touch, warmth, and so on.
To determine: The receptors that are stimulated while probing needles in an individual.
Introduction: Skin is the largest largest sense organ of the body. It is the all over covering of the body of an organism. The skin has several types of receptors which are are stimulated under different conditions like warmth, pain, itch, touch, and so on.
To determine: The reason due to which the individual feels only one probe even though the individual is stimulated by two needle probes.
Introduction: The autonomic nervous system (ANS) helps in maintaining a steady state in the internal environment, which is called homeostasis. The two branches of ANS are the sympathetic nervous system and parasympathetic nervous system. These systems control the different responses to different stimuli.

Want to see the full answer?
Check out a sample textbook solution
Chapter 10 Solutions
Human Physiology: An Integrated Approach (7th Edition)
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning


