Concept explainers
What is the difference between histology and radiography?

To review:
The difference between radiography and histology.
Introduction:
Anatomy can be defined as the branch of science that concerns with the identification as well as description of the body structures of living organisms. Several branches are included in the field of anatomy. Gross anatomy is one such branch and it includes the study of body features for which examination is possible with the naked eye.Â
Explanation of Solution
Histology or microscopic anatomy includes the study of the structures that are only able to be observed with a microscope. The structures like cells and tissues are the main factors to study in histology and microscopic anatomy. Radiography is another branch of anatomical studies. Differences between histology and radiography are described below:
Want to see more full solutions like this?
Chapter 1 Solutions
HUMAN ANATOMY W/MODIFEDMAS AP
Additional Science Textbook Solutions
Biological Science (6th Edition)
Chemistry: The Central Science (14th Edition)
Organic Chemistry (8th Edition)
Laboratory Manual For Human Anatomy & Physiology
General, Organic, and Biological Chemistry - 4th edition
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageCase Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:CengageMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning

