Concept explainers
To determine: The complementary sequence of the DNA strand and comparison between both sequences.
Introduction: DNA or Deoxyribonucleic acid is a type of
To determine: The relationship between both strands of DNA.
Introduction: The complementary DNA can be used in the manufacturing of new copies of DNA and used as a molecular tool in various fields of science. During the replication of the DNA, the strands of DNA unwound from each other, and polymerase enzyme is used for producing a complementary copy of DNA.
Want to see the full answer?
Check out a sample textbook solutionChapter 1 Solutions
INTRO TO GEN ANALYSIS W/ACHIEVE ACCESS
- Write out the DNA sequence using the following instructions: This is a double stranded DNA hydrogen bonding with each other following the principle of complementary base-pairing Each strand contains ten nucleotides Each strand contains all four different types of nucleotides You should indicate clearly the directionality of each strand in your answer You do not need to draw the full nucleotide structure. Use the one-letter code (A, T, G, C, or U) to represent each nucleotidearrow_forwardIn a sample solution given to be analyzed;CATAGCTTTGTTAAA (DNA nucleotide chain). Show the 5 'and 3' ends by writing in triplet (codon) form. Find the number of Hydrogen bonds in the double helix DNA strand at the beginning.arrow_forwardGiven the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’ a. Write the sequence for the complementary DNA strand. b. Write the sequence of the RNA complementary to the strand shownarrow_forward
- Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.arrow_forwardWrite the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA TGTGCGCGCGGGGCGarrow_forwardThe following is the base sequence on the coding strand of a DNA molecule. AAT GCC AGT GGT TCG CAC Rewrite the base sequence above and underneath write the base sequence for the template DNA strand. Write the base sequence for the strand of mRNA transcribed from the original strand of DNA or template strand. Remember transcribing means making mRNA from DNA. Write the amino acid sequence translated from this mRNA. Translating means making an amino acid chain from mRNA. A) If the fourth nucleotide in the coding DNA strand was changed from a G to a C, what would be the base sequence of the new strand of mRNA? b) What would the resulting amino acid fragment be? A) If a G were added to the coding DNA strand after the third nucleotide, what would be the base sequence of the resulting mRNA? B) What would the resulting amino acid fragment be?arrow_forward
- If the sequence T-A-C-C-C-T appears on the informational strand of DNA, what sequence appears opposite it on the template strand? Label your answer with 3′ and 5′ ends.arrow_forwardThe sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you identify important features – capitalization does not affect the nucleotide indicated. 5’…atacaATGcATGTCAaCTAcg[a]agatccgTAGaTAACATtCATatc…3’ a. Underneath that strand write the sequence of the strand of DNA it would be paired with in a doublestranded helix. Use the single letter code A-adenosine, G-guanosine, T-thymine, U-uracil and C-cytosine and remember to label the 5’ and 3’ ends. b. Next, write the sequence of a possible mRNA transcript of the double stranded DNA above. Remember that an mRNA must be translatable by a ribosome into a protein. Be sure to indicate 5’ and 3’ ends. c. Using the genetic code, translate your mRNA into the appropriate protein. Write the amino acid sequence of the protein below the mRNA sequence in (b) and label the amino and carboxy terminals d. Suppose the bracketed, bold [a] were mutated to be a t. Write the new sequence of your mRNA transcript…arrow_forwardProtein synthesis is a complicated process involving DNA being transcribed to RNA, which is then translated into amino acids. Complete the DNA-to-amino acid table for three consecutive codons with the appropriate nucleotides and amino acids using a codon table. Nucleotide and amino acid options can be used multiple times or not at all. 5' to 3' DNA strand T T A G A G 3' to 5' DNA strand A A T C T C G C G transcribed mRNA U U A G A G C G C TRNA anticodon A. A U C U G C G amino acid leucine glutamic acid Answer Bank A glutamic acid leucine cysteine arginine proline Uarrow_forward
- The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. ССТАССТТАТGCСАAGTTGGGGATАААСТС The left end of this molecule is the end. How many amino acids will be in the protein translated from this sequence? What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence? The label on the end of the protein that is translated first is th v end. 5' Please answer all parts of the question. carboxyl 3' aminoarrow_forwardThe sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGGGATAAACTC The left end of this molecule is the end. How many amino acids will be in the protein translated from this sequence? What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence? The label on the end of the protein that is translated first is the + Jend.arrow_forwardUse the genetic code table to determine the amino acid sequence of the given message strand of DNA below, from N to C terminal. All introns were removed in this sequence for simplicity. Write the amino acids in their 3-letter abbreviation and separate with a dash.arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning